ID: 1027265408

View in Genome Browser
Species Human (GRCh38)
Location 7:76492432-76492454
Sequence CCACGTACCCAGAGAGCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 2, 1: 0, 2: 0, 3: 13, 4: 109}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027265408_1027265414 0 Left 1027265408 7:76492432-76492454 CCTTTTGCTCTCTGGGTACGTGG 0: 2
1: 0
2: 0
3: 13
4: 109
Right 1027265414 7:76492455-76492477 GCCTGATGACGGTGGGCGCTCGG 0: 2
1: 0
2: 0
3: 8
4: 120
1027265408_1027265412 -8 Left 1027265408 7:76492432-76492454 CCTTTTGCTCTCTGGGTACGTGG 0: 2
1: 0
2: 0
3: 13
4: 109
Right 1027265412 7:76492447-76492469 GTACGTGGGCCTGATGACGGTGG 0: 2
1: 0
2: 0
3: 3
4: 50
1027265408_1027265413 -7 Left 1027265408 7:76492432-76492454 CCTTTTGCTCTCTGGGTACGTGG 0: 2
1: 0
2: 0
3: 13
4: 109
Right 1027265413 7:76492448-76492470 TACGTGGGCCTGATGACGGTGGG 0: 2
1: 0
2: 0
3: 1
4: 30
1027265408_1027265416 1 Left 1027265408 7:76492432-76492454 CCTTTTGCTCTCTGGGTACGTGG 0: 2
1: 0
2: 0
3: 13
4: 109
Right 1027265416 7:76492456-76492478 CCTGATGACGGTGGGCGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027265408 Original CRISPR CCACGTACCCAGAGAGCAAA AGG (reversed) Intronic
903293558 1:22329692-22329714 CCATTTACCCAGAGGGCACAAGG - Intergenic
905403492 1:37718750-37718772 CCACGCGCCCACAGAGCCAAAGG + Exonic
906542900 1:46601862-46601884 CCACGTACTCAGAGTACATATGG + Intronic
913093594 1:115496382-115496404 CCAGGTGCCCAGAAACCAAAGGG + Intergenic
913157239 1:116111855-116111877 ACACGTACACAGAGTGCACACGG - Intronic
915892624 1:159785461-159785483 TCCAGAACCCAGAGAGCAAAAGG - Intergenic
919937740 1:202265692-202265714 CCACTTAACCAGGGAGGAAAGGG - Intronic
921491960 1:215788250-215788272 CCATGTTCCCAGAGAGAAAAGGG - Intronic
923776029 1:236979166-236979188 TGAAGTACCCAGAGAGCAAATGG - Intergenic
1062838723 10:652978-653000 CCACGTCCCCAAAGACCAAGGGG + Intronic
1063297323 10:4820098-4820120 CCACATACACAGAAAGCAACCGG - Intronic
1063440446 10:6068711-6068733 CCACGCTCCCAGAAAGCAAAGGG - Intergenic
1067740895 10:48895439-48895461 CCACAGGCCCAGAGAGCCAAGGG - Intronic
1069769404 10:70888079-70888101 CCCCGTACCCAGAGTGCCAGCGG + Intronic
1072604895 10:96972430-96972452 TCACATTTCCAGAGAGCAAATGG + Intronic
1074075373 10:110118851-110118873 CTGCATACCCAGAAAGCAAAAGG + Intronic
1074917666 10:117972770-117972792 CCACAGAACCAGAGAGCAGAAGG - Intergenic
1075060982 10:119256529-119256551 CCATGTACCCAGAGAGCAGCAGG - Intronic
1076516712 10:131049431-131049453 CCAGGCACCCAGACAGCACAAGG - Intergenic
1079874548 11:25840294-25840316 CAACGTTCCCAGAGAGGACATGG - Intergenic
1086382748 11:86274707-86274729 CCAACTACCCAGAGTGTAAATGG - Intronic
1086425702 11:86680547-86680569 CCACAGCCCCAGTGAGCAAAAGG - Intergenic
1088786302 11:113185223-113185245 CCAAGAACCAAGAGAGCAGATGG + Intronic
1091340312 11:134806930-134806952 CCACCTTCCCAGAGAGCAGCTGG - Intergenic
1093894380 12:24561105-24561127 TCACATACCCAGATAGCCAAAGG - Intergenic
1097195583 12:57240925-57240947 TCACATACCCAGGGAACAAACGG + Intergenic
1097587572 12:61532561-61532583 CCCCGTACCCAGAGGGGAAGTGG - Intergenic
1098584201 12:72137047-72137069 CACCGTTCCCAGAGAGGAAATGG - Intronic
1103330597 12:120151266-120151288 ACAAGTACGCAGAGCGCAAAGGG - Exonic
1105401758 13:20102384-20102406 CCAGAGAGCCAGAGAGCAAAGGG + Intergenic
1106702710 13:32246885-32246907 CAAGGTACCCAGGAAGCAAATGG + Intronic
1107435329 13:40376438-40376460 CCATGGCCCCAGAGAGCCAAGGG + Intergenic
1109336155 13:60997210-60997232 CCCTGGACCCAGAGAGCACAAGG - Intergenic
1113308728 13:109108669-109108691 CCAGGTGCAAAGAGAGCAAATGG + Intronic
1114493214 14:23116025-23116047 CCACGTACTGAGGCAGCAAAGGG + Intergenic
1119515824 14:75247449-75247471 CCATATAGCCACAGAGCAAATGG + Intronic
1119977210 14:79038389-79038411 CCACTAACCCAAAGATCAAATGG + Intronic
1122743930 14:103887185-103887207 AGAGGTACCCAGAGAGCAAAGGG - Intergenic
1122950789 14:105043413-105043435 CCAAGGTCCCAGAGAGTAAAGGG + Intergenic
1129270365 15:74416231-74416253 CCAGGTCCCCACAGAGCAGACGG + Intronic
1129325379 15:74797833-74797855 CCAAGGACCCACAGAGCATAAGG + Intronic
1132092719 15:98958954-98958976 CCTCGTGCCCAGAGAGCCTACGG - Exonic
1138650258 16:58456477-58456499 CCAGGCCCCCAGAGATCAAACGG - Intergenic
1139962283 16:70724909-70724931 CCACCTACCCAGAATGCAGATGG - Intronic
1140217849 16:73022671-73022693 CCACGATCCCAGACAGCACAGGG + Intronic
1141327139 16:83071483-83071505 CCTCCTGCTCAGAGAGCAAAGGG - Intronic
1142195862 16:88739078-88739100 CCACGCACCCAGGGAGCAGCGGG + Intronic
1144066710 17:11630785-11630807 CCACGCACACAAAAAGCAAATGG + Intronic
1145868385 17:28255264-28255286 CCAGGTTCCCAGAGAGCAGCAGG + Intergenic
1146124678 17:30222003-30222025 CCAAGCACCCAGAGATCAATTGG - Exonic
1149017473 17:51924879-51924901 CCAGGTATCCAGAAATCAAAAGG + Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151991015 17:77574325-77574347 CCACCTACCCAAAGAGCACAAGG - Intergenic
1152232785 17:79123016-79123038 TCACGGACACAGAGAGCAGAAGG + Intronic
1152337008 17:79704497-79704519 CCACAGAGACAGAGAGCAAATGG + Intergenic
1155271658 18:24147704-24147726 ACAAGTACCCAGAGAGAAAATGG + Intronic
1156385304 18:36599155-36599177 CCCCATACCCAGACAGCAGAGGG - Intronic
1166589439 19:43984099-43984121 CCACGACTCCACAGAGCAAATGG - Intronic
926220031 2:10929600-10929622 CCACCAACCCCAAGAGCAAATGG - Intergenic
928278701 2:29924649-29924671 CCATGTACCAAGAGAGGAAGTGG + Intergenic
929551888 2:42898876-42898898 CCTGATAACCAGAGAGCAAATGG - Intergenic
931172190 2:59815084-59815106 CATAGTACCCAGAGAGCAAATGG + Intergenic
932581245 2:72993984-72994006 CCAGGTACCCTGAGAGCAGTGGG - Intronic
934158567 2:89226386-89226408 CCAGGTACACAGAGAACACAGGG + Intergenic
934208705 2:89956041-89956063 CCAGGTACACAGAGAACACAGGG - Intergenic
935212703 2:100952224-100952246 CCTCGTGCACAGAGGGCAAAGGG + Intronic
935469064 2:103434859-103434881 CCATGTCCCCTGAGAGGAAAGGG + Intergenic
940373315 2:152925593-152925615 CCACATGCCCAGAGGGCCAAGGG - Intergenic
941200653 2:162504868-162504890 GTGTGTACCCAGAGAGCAAATGG + Intronic
1175374676 20:58515805-58515827 CCACGAACCCAGAGAGGGAGAGG + Intergenic
1178117335 21:29430831-29430853 CCATGTGCTCAGAGACCAAAGGG - Intronic
1179999633 21:44989463-44989485 CCACAAACCCAGAGAACACAGGG - Intergenic
1182104111 22:27676890-27676912 GCAAGTTCCAAGAGAGCAAAAGG + Intergenic
1182155545 22:28069026-28069048 CCCAGTACTCAGAGACCAAAAGG + Intronic
1183228473 22:36566076-36566098 CCAAGTACCCTGAGAGGAAGCGG + Intronic
1184106388 22:42369553-42369575 CCACGGAAGCAGAGAGGAAAAGG - Intergenic
952407867 3:33020892-33020914 CTACATACACAGAGAGAAAAAGG + Intronic
956379270 3:68648725-68648747 CCAAGTTCCCAAAGAGGAAATGG + Intergenic
968916753 4:3500015-3500037 CCAAGTACCCACAGAGCAGAAGG - Intronic
969386657 4:6854473-6854495 TCACGCACCCAGTGAACAAATGG - Intronic
969447340 4:7252903-7252925 CCACGTACCCAGCCAGCTAAGGG - Intronic
970045524 4:11848844-11848866 CCACCTACCCAAAGACAAAAAGG + Intergenic
971160504 4:24128935-24128957 CCACCTACTCAGAGAGTGAAGGG - Intergenic
979812036 4:125048235-125048257 ACAGGTAACCAAAGAGCAAATGG + Intergenic
981562311 4:146061580-146061602 CCACATACCCAGAAAGCTGAGGG - Intergenic
985907964 5:2856028-2856050 CCAGGATCCCAGAGAACAAAAGG + Intergenic
987171526 5:15264014-15264036 GCACCTAACCACAGAGCAAAGGG + Intergenic
990033255 5:51288010-51288032 CCACGTACCTAGTCAGCCAAAGG + Intergenic
992994432 5:82318547-82318569 CAAAGTACCCTGAAAGCAAAGGG + Exonic
993668138 5:90726636-90726658 ACACATACCCAGAGAGAGAAAGG - Intronic
993866176 5:93199168-93199190 CCACTTACCTACAGAGTAAAAGG + Intergenic
995095740 5:108233857-108233879 CCAGATACCCAGGGTGCAAAAGG + Intronic
997312226 5:132896611-132896633 CTAAGTACCCCGAGAGCAATAGG - Exonic
1006385163 6:33726735-33726757 CCGAGTACCCAGAGAACAAGCGG - Exonic
1006418803 6:33920749-33920771 CCAGGTACCAAGAGAGGAGAGGG + Intergenic
1007324927 6:41052795-41052817 CCACGTTCCCCCAAAGCAAATGG + Intronic
1010413373 6:75586161-75586183 CAACGCACCCAGAAAGCAAATGG + Intergenic
1011815045 6:91179590-91179612 CCATGTAGTCAGAGAGCACAAGG - Intergenic
1014155879 6:118109202-118109224 TCACCTACTCAGAGAGGAAATGG + Intronic
1017519997 6:155193898-155193920 ACATGTCCTCAGAGAGCAAAAGG + Intronic
1018208402 6:161456808-161456830 CCACATGCCCAGAGAGCTCAGGG + Intronic
1018399295 6:163405997-163406019 CCAGGCACCCAGAGAGGAACTGG + Intergenic
1019283872 7:214558-214580 CCACGTAGCCACAGAGCGACGGG + Intronic
1024232255 7:47371489-47371511 CCACCTGCCCAGAGAGCACCAGG + Intronic
1025974319 7:66357559-66357581 CCACATACTCAGATAGAAAAAGG - Intronic
1027265408 7:76492432-76492454 CCACGTACCCAGAGAGCAAAAGG - Intronic
1027316779 7:76990549-76990571 CCACGTACCCAGAGAGCAAAAGG - Intergenic
1028450633 7:90978099-90978121 CCAGGTACAGAGAGGGCAAAGGG + Intronic
1030094454 7:105885603-105885625 CCAAGTACCAAGTGAGCAGAGGG + Intronic
1030694526 7:112570290-112570312 CCTCATACCCAGAGAGCCAAAGG - Intergenic
1036486959 8:9188217-9188239 CCACGTACCATGGGTGCAAAGGG + Intergenic
1038027939 8:23608943-23608965 CCAAGAACCCAGAGAACCAATGG - Intergenic
1046045487 8:108959136-108959158 CCAAGTGTCCAGCGAGCAAATGG + Intergenic
1047183005 8:122606939-122606961 CCAAGAGCCCAGAGAGCAACTGG + Intergenic
1047618073 8:126579810-126579832 CCACATATCCACAGAGCACAAGG - Intergenic
1049738590 8:144223089-144223111 TCACCTGCCCAGAGAACAAATGG - Exonic
1052642812 9:31191433-31191455 TCACCTACCCACAGAGCAACTGG + Intergenic
1059872993 9:118598788-118598810 CCAAGATCCCACAGAGCAAATGG - Intergenic
1060153568 9:121303673-121303695 TCAGGTAACCAGAGAGGAAAGGG - Intronic
1060949498 9:127592520-127592542 TCTCATACCAAGAGAGCAAATGG + Intergenic
1185828051 X:3271873-3271895 CCTGCTACCCAGAGAGAAAAGGG + Exonic
1190948259 X:55117068-55117090 CCACAAACCCAGGGAGGAAATGG + Intronic
1197635695 X:128912629-128912651 TCTGGTACCCAGAGAGCAAAGGG + Intergenic
1201705650 Y:16933760-16933782 TCATGTAACCAGAGATCAAAAGG - Intergenic