ID: 1027265700

View in Genome Browser
Species Human (GRCh38)
Location 7:76494163-76494185
Sequence GGGTGCCCCTGACCCCTCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 2, 1: 1, 2: 1, 3: 9, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027265694_1027265700 5 Left 1027265694 7:76494135-76494157 CCTCAGAAGAGCAGTCTTGGGTG No data
Right 1027265700 7:76494163-76494185 GGGTGCCCCTGACCCCTCGTGGG 0: 2
1: 1
2: 1
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027265700 Original CRISPR GGGTGCCCCTGACCCCTCGT GGG Intronic