ID: 1027265700

View in Genome Browser
Species Human (GRCh38)
Location 7:76494163-76494185
Sequence GGGTGCCCCTGACCCCTCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 2, 1: 1, 2: 1, 3: 9, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027265694_1027265700 5 Left 1027265694 7:76494135-76494157 CCTCAGAAGAGCAGTCTTGGGTG 0: 2
1: 1
2: 4
3: 16
4: 144
Right 1027265700 7:76494163-76494185 GGGTGCCCCTGACCCCTCGTGGG 0: 2
1: 1
2: 1
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027265700 Original CRISPR GGGTGCCCCTGACCCCTCGT GGG Intronic
900140357 1:1137152-1137174 GGGTCCCCCTGCCCCCTCTGCGG + Intergenic
900172175 1:1274386-1274408 GGATGCCCCTGACCTCCCCTTGG + Intergenic
900176407 1:1293319-1293341 GGGTGTCCCTCACCCCACCTGGG - Exonic
900412436 1:2518864-2518886 GGGTGCCCCTGCCCCCGCAGAGG - Intronic
900609557 1:3538805-3538827 GGGGGCACCTGAGCCCTCGAGGG + Intronic
901195821 1:7439248-7439270 TGCTGCCACTGACCCCTCCTAGG + Intronic
902546970 1:17196118-17196140 GGGTGCCTGTGTCCCCTCATGGG - Intergenic
905309656 1:37040570-37040592 GGCTGCACCTGTCCCCTCATGGG + Intergenic
907051645 1:51333620-51333642 GGGAGCCCCTGACCCATCTATGG - Intronic
907450605 1:54543250-54543272 AGTTGCTCCTGACCCCTCCTAGG - Intronic
916466099 1:165075942-165075964 GGGTGCTACTGGCCCCTAGTGGG + Intergenic
1062834840 10:628865-628887 GGGTGCCCCTGGCATCTGGTGGG - Intronic
1063460786 10:6213838-6213860 GGGCGCCTCTGTCCCCTGGTCGG + Intronic
1063978328 10:11434530-11434552 GGATGCTGCTGACCCCTAGTGGG - Intergenic
1064211812 10:13366195-13366217 GGGCGCCCCTGACCATTTGTTGG + Intergenic
1067070465 10:43127157-43127179 GGTTCCCCCAGACCCCTCCTGGG + Intronic
1067286745 10:44912590-44912612 GGGAGCCCCTGACCCCTCTGAGG + Intronic
1070792274 10:79196561-79196583 GACTGCCCGTGACCCCACGTGGG + Intronic
1076948771 10:133667660-133667682 GGGTCACCCTGCTCCCTCGTGGG + Exonic
1076949755 10:133670959-133670981 GGGTCACCCTGCTCCCTCGTGGG + Intronic
1076950739 10:133674258-133674280 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076951729 10:133677568-133677590 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076952718 10:133680878-133680900 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076953702 10:133684177-133684199 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076955675 10:133743839-133743861 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076956665 10:133747149-133747171 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076957652 10:133750458-133750480 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076958637 10:133753757-133753779 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076959626 10:133757067-133757089 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076960610 10:133760366-133760388 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1077229703 11:1453247-1453269 GCAGGCCCCTCACCCCTCGTCGG + Intronic
1077484448 11:2832372-2832394 GGGTGCCTGTGTCCCCTCCTGGG + Intronic
1077532860 11:3105421-3105443 GGCTCCCCATGACCCCTCATGGG - Intronic
1094567964 12:31617013-31617035 GGGTGCCTCTCACCCCACATAGG + Intergenic
1096689975 12:53314542-53314564 TGGTGCCCCTGGCCCCTGGATGG - Intronic
1102000916 12:109557718-109557740 GGGTGCCACTGGCACCTGGTGGG - Intronic
1103984761 12:124759948-124759970 GGGTGGCCCTGGCACCTCGCGGG + Intergenic
1106207713 13:27615196-27615218 GGGTTCCCATAACCCCTCTTTGG + Intronic
1108233035 13:48370487-48370509 GGGTTCCCATGACACCTCTTAGG + Intronic
1113361116 13:109632465-109632487 GGGTGCCACTGACATCTAGTAGG + Intergenic
1119266728 14:73267144-73267166 GGGTGCCCCTGGCATCTAGTGGG - Intronic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1132479586 16:160424-160446 GGGTGCCCGGGACAGCTCGTGGG + Intronic
1132630324 16:914210-914232 GGCAGTCCCTGACCCCTCCTGGG + Intronic
1132681978 16:1146147-1146169 GGGTGCCCCTCTCCCCTGCTTGG - Intergenic
1132751184 16:1458465-1458487 GGGTGCCCCTGCCCTGTGGTGGG - Intronic
1133465093 16:6020446-6020468 AGGTGCCCCGAACCCCTTGTGGG + Intronic
1134232161 16:12437684-12437706 GTGTGCTCCTGACCCCTCCCAGG - Intronic
1134697329 16:16234165-16234187 GGGTGCCCATGCCACCTCCTAGG + Intronic
1134974518 16:18560511-18560533 GGGTGCCCATGCCACCTCCTAGG - Intronic
1142307754 16:89295125-89295147 GGGTGCCTCTGACCCCGGGGTGG + Intronic
1142390463 16:89796364-89796386 GGGTGCCGCTGAGGCCCCGTCGG - Intronic
1142983416 17:3684264-3684286 GGGTGCCCCTAACATCTAGTGGG + Intronic
1144642109 17:16943364-16943386 GGGTGCCCGTGACCCCTTCTGGG - Intronic
1144942111 17:18948877-18948899 GGGTGCCCCCGACCCTGCCTGGG - Intergenic
1145209619 17:21003528-21003550 GGGTCCCCCTGACCCCTGGAGGG + Intronic
1147230843 17:39016648-39016670 GGCTTCCCATGACCCCTCTTTGG - Intergenic
1151179112 17:72312862-72312884 GGGTGCTCCTGACATCTCGTGGG - Intergenic
1152242483 17:79167757-79167779 GGGTGCCCTGGACCCCAGGTAGG - Intronic
1152987143 18:331236-331258 GGGTGCCCCTGACCCCTAGTTGG - Intronic
1156033514 18:32741184-32741206 GTGTGCACCAGTCCCCTCGTGGG - Intronic
1157500350 18:48186150-48186172 GGGTGCCCCTCGCTCCTCGCAGG + Intronic
1159004748 18:63002151-63002173 GGGTGCCCCTGCCTCCCTGTGGG - Intergenic
1160539256 18:79611513-79611535 GGGTGGCGCTGACCCATCGCCGG + Intergenic
1161457677 19:4377714-4377736 GGGTGCCCCTGGCCGCTCAGAGG + Intronic
1161868830 19:6854776-6854798 GGGAGCCCCTGACCCACCCTAGG + Intronic
1162045156 19:7994307-7994329 GGGTGCTACTGACACCTGGTGGG + Intronic
1162187450 19:8916953-8916975 GGGTAGCCCTGACCCCTATTTGG - Intronic
1162479987 19:10922325-10922347 GGGGGCCCCTGAAGCCTCGGCGG - Exonic
1163762764 19:19146294-19146316 GGGGGCCCATCACCCCTCGAGGG + Exonic
1164063330 19:21693902-21693924 GAGTGCCCCTTTCCCCTCCTTGG - Intergenic
1164794235 19:31013600-31013622 GGGTGCCCCGGACCCATCCTGGG + Intergenic
1166099086 19:40560402-40560424 AGGTGCCCCTCATCCCTCCTCGG + Exonic
1166350869 19:42197493-42197515 GGGTGCCCCTGCCCACACCTTGG - Intergenic
1167602847 19:50464713-50464735 GGGAGCCCCTGACCCAGCTTGGG + Intronic
1168003645 19:53468288-53468310 GGCTTCCCCTGAGCCCACGTTGG + Intronic
926310356 2:11670250-11670272 GGGTGTCCCTGAGCCAACGTGGG + Intergenic
927955307 2:27203727-27203749 TGGTGCACCTGACCCCTATTTGG - Intronic
928803650 2:35125314-35125336 GGTTGCCCCTCCCCCCTGGTAGG - Intergenic
932713150 2:74082464-74082486 GGGTGTCACTGAGCCCTGGTGGG + Intronic
946307527 2:218864838-218864860 TGGGGCCCCTGACCCATCGTGGG + Intronic
946811632 2:223531378-223531400 GGGTTCCCATGACTCCTCTTTGG - Intergenic
948822583 2:240557573-240557595 AGGTGTCCCTGTCCCTTCGTGGG + Intronic
948874748 2:240820491-240820513 GCGTGCCCCTGAGACCTCGCGGG + Intergenic
948962815 2:241354712-241354734 GGGTGGTACTGACCCCTGGTAGG - Intergenic
1169216997 20:3799881-3799903 GGGTGCCCCTGGCCTATCATAGG + Intronic
1172007424 20:31826956-31826978 GGCTGCCCCTGACCCTTCCCAGG - Intronic
1174510303 20:51046213-51046235 AGGTGCTCCTGACACCTAGTGGG + Intergenic
1175105695 20:56613251-56613273 GGGTGCCCCTGGCATCTAGTGGG - Intergenic
1175217732 20:57400378-57400400 GGGTCCCCCTGTCCTCTCCTGGG + Intronic
1175836828 20:62001385-62001407 GGCTGCCCCTGACACCTGGAAGG + Intronic
1175987541 20:62771437-62771459 GGGGGCCCCTGACCTCTCTGGGG + Intergenic
1176307004 21:5128818-5128840 GGGTAGTCCTGACCCCGCGTGGG - Intergenic
1178390480 21:32193960-32193982 GGGTACCACTGGCCTCTCGTGGG - Intergenic
1179850055 21:44133212-44133234 GGGTAGTCCTGACCCCGCGTGGG + Intergenic
1179973515 21:44849478-44849500 GTGGGCCTCTGACCCATCGTGGG - Intergenic
1180081677 21:45490193-45490215 GGGTGCCCCGGACTCCTCGTGGG + Intronic
1182669081 22:31980763-31980785 AGGTGCCCCTGAACCCTCAGAGG - Intergenic
950263988 3:11561501-11561523 GGTGGCCCGTGAGCCCTCGTGGG + Intronic
953414408 3:42707430-42707452 GGGAGCCCCTGACCCTGCATGGG - Intronic
961930857 3:130531325-130531347 GGGTGCCACTGACATCTAGTGGG - Intergenic
962009875 3:131382200-131382222 GCGTGGCCCTGACCCGACGTGGG - Exonic
962359435 3:134725451-134725473 GGGTGGCCCTGCCCCTTCGGTGG - Intronic
963946888 3:151155552-151155574 GGGTGTCCCTGACACATCCTGGG + Intronic
963956750 3:151262441-151262463 GGGTGGCCCTGACACCTGGCTGG + Intronic
966201703 3:177365229-177365251 GGGAGCCTCTGGCTCCTCGTGGG + Intergenic
966248708 3:177837750-177837772 GGGTGGGCCTGACTCCTCCTTGG + Intergenic
967067716 3:185935370-185935392 GTGTGTCCCTCATCCCTCGTTGG - Intronic
968698069 4:2042298-2042320 GGGCGCCGCTGACCCCTCGCTGG + Intronic
970866834 4:20768950-20768972 GGGTGACCCTGAGAACTCGTGGG - Intronic
979657186 4:123209143-123209165 GGGTTCCCATGACCCCTGCTTGG - Intronic
980155009 4:129093568-129093590 CGGTGCCCCGGACCACTCCTTGG + Exonic
981933542 4:150215429-150215451 GAGTTCCCATGACCCCTCTTTGG + Intronic
983675754 4:170290320-170290342 GGGTCCCCTTGGCCCCTTGTAGG + Intergenic
984191948 4:176616408-176616430 GGGTGCCACTGACATCTAGTTGG - Intergenic
985119151 4:186622444-186622466 GGGTGCTCCTGGCGTCTCGTGGG + Intronic
985446148 4:190022134-190022156 GGGTCACCCTGCTCCCTCGTGGG - Intergenic
985452225 4:190068444-190068466 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
985453209 4:190071741-190071763 GGGTCACCCTGCTCCCTCGTGGG + Exonic
985454199 4:190075034-190075056 GGGTCACCCTGCTCCCTCGTGGG + Exonic
985455187 4:190078327-190078349 GGGTCACCCTGCTCCCTCGTGGG + Exonic
985456175 4:190081627-190081649 GGGTCACCCTGCTCCCTCGTGGG + Exonic
985457159 4:190084921-190084943 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
985458146 4:190088214-190088236 GGGTCACCCTGCTCCCTCGTGGG + Exonic
985459135 4:190091514-190091536 GGGTCACCCTGCTCCCTCGTGGG + Exonic
985463388 4:190174283-190174305 GGGTCACCCTGCTCCCTCGTGGG + Exonic
994913419 5:105943201-105943223 GGGTTCCCTTGACCCCTTCTCGG + Intergenic
997647192 5:135489379-135489401 GGGTACACCTCACCCCTCCTAGG + Intergenic
1001301207 5:170535114-170535136 TGCTGCCCCTGACCTCTCCTAGG - Intronic
1001401884 5:171450913-171450935 GGGTGCCGCTGGCCCCTGCTGGG - Intronic
1001960978 5:175880277-175880299 GGGCCCCCCTGACCCCTGCTGGG - Exonic
1002562281 5:180090555-180090577 GGGGGCCCCTGACGCCGCGCTGG - Intergenic
1002570928 5:180138939-180138961 GGCTGCACCTGACCTCTGGTGGG + Intronic
1004122652 6:12839562-12839584 TGGTCCCACTGACCCCTCATAGG + Intronic
1007358301 6:41336457-41336479 GGGTGCCCCTCACCCCCTTTTGG + Intronic
1016880885 6:148911049-148911071 GGCTGGCCCTGACCCCTCCAGGG + Intronic
1017725383 6:157273377-157273399 GGGTGCTACTGGCACCTCGTGGG - Intergenic
1020862767 7:13515665-13515687 GGGTTTCCATGACCCCTCTTGGG + Intergenic
1021811772 7:24409371-24409393 GGCTGCCCCTGAGCCCTCAGCGG - Intergenic
1022359078 7:29642149-29642171 GAGTGCCCCTTCCCCCTCCTCGG - Intergenic
1027265700 7:76494163-76494185 GGGTGCCCCTGACCCCTCGTGGG + Intronic
1027317070 7:76992280-76992302 GGGTGCCCCTGACCCCTCGTGGG + Intergenic
1029592768 7:101518297-101518319 GGGTGCCCCTCAGCCCTCTGGGG + Intronic
1031074935 7:117202783-117202805 GGGTTCCCCGGACCTCTCTTGGG + Intronic
1035301527 7:157900696-157900718 GGGTGCCCCTGAGCACATGTAGG - Intronic
1035315326 7:157993884-157993906 GGGGGCCACTGACCCCCCTTGGG - Intronic
1038848919 8:31255302-31255324 GGGTTCCCATGACCCTTCTTTGG + Intergenic
1039790068 8:40868551-40868573 GGCTGCCACTGAGCCCTCCTTGG - Intronic
1041502298 8:58552861-58552883 GGGAGCCCCTGTTCCCTCTTGGG - Intergenic
1042369759 8:67977999-67978021 GGGTTCCCCTCACCCTTCCTTGG - Intronic
1048345225 8:133570827-133570849 GGGTGGCCCTGCCCCCACGCAGG + Intronic
1049748603 8:144273330-144273352 CGGTGCCCCTGACCCTGCCTGGG - Intronic
1049918189 9:338526-338548 GTGTGCTCCTGACCCATCTTGGG + Intronic
1056758032 9:89394595-89394617 GGGTGCCCTTGCCCCGCCGTGGG - Intronic
1057177440 9:93010405-93010427 AGGTGCCCCTGCACCCTCCTGGG - Intronic
1058710856 9:107677882-107677904 GGATACCCCAGACCCCTTGTAGG - Intergenic
1061793021 9:133068457-133068479 GGGTGCTCCTGGCACCTCGTGGG + Intronic
1061795626 9:133084241-133084263 GGGTGCTCCTGGCACCTCGTGGG + Intronic
1061903356 9:133684213-133684235 GGGTGCCACTGGCACCTAGTGGG + Intronic
1190062774 X:47221790-47221812 GGGTGGCCCCTACCCCTCCTGGG + Intronic
1194054075 X:89109712-89109734 AGGTTCCCCTTCCCCCTCGTAGG + Intergenic
1194379911 X:93178966-93178988 AGGTGCCACTGACCCCTTTTGGG + Intergenic
1194819795 X:98491388-98491410 GGGTTCCCATGACCCCTTTTGGG - Intergenic
1195287347 X:103397954-103397976 TGGTGCCCATGGCCCCTCCTAGG - Intergenic
1196703832 X:118699297-118699319 GGTTGCCACTGACACCTAGTGGG + Intergenic
1200118215 X:153778489-153778511 GGGTGCGCCTGTCCACACGTGGG + Intronic