ID: 1027269805

View in Genome Browser
Species Human (GRCh38)
Location 7:76513156-76513178
Sequence CCTGCCCAGCGCTACCTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027269805_1027269811 -3 Left 1027269805 7:76513156-76513178 CCACCAAGGTAGCGCTGGGCAGG 0: 1
1: 0
2: 0
3: 18
4: 124
Right 1027269811 7:76513176-76513198 AGGAGGGGCGCTGCCCCCAGTGG 0: 1
1: 0
2: 0
3: 26
4: 286
1027269805_1027269816 14 Left 1027269805 7:76513156-76513178 CCACCAAGGTAGCGCTGGGCAGG 0: 1
1: 0
2: 0
3: 18
4: 124
Right 1027269816 7:76513193-76513215 CAGTGGACTCACGATCTCTCTGG No data
1027269805_1027269817 15 Left 1027269805 7:76513156-76513178 CCACCAAGGTAGCGCTGGGCAGG 0: 1
1: 0
2: 0
3: 18
4: 124
Right 1027269817 7:76513194-76513216 AGTGGACTCACGATCTCTCTGGG 0: 1
1: 0
2: 0
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027269805 Original CRISPR CCTGCCCAGCGCTACCTTGG TGG (reversed) Intronic
901669864 1:10849896-10849918 CCTGCCCAGGGCTTCAGTGGAGG - Intergenic
902605955 1:17569525-17569547 CCTGCCCAGAGCTCCCTCGTGGG + Intronic
905225849 1:36478727-36478749 CATGCCCTGCACTACCTTGGAGG + Intronic
905313724 1:37067967-37067989 CCTGACCAGGGCTGCCATGGAGG + Intergenic
905790121 1:40785053-40785075 CCTGCCCTGCCCTACCCTGCCGG + Intronic
906024476 1:42661516-42661538 CCTCCCCACCCCAACCTTGGAGG + Intronic
906246985 1:44283185-44283207 CATGCCTAGCTCTGCCTTGGGGG + Intronic
906381167 1:45332917-45332939 CCTGGCCAGTGCTTCCCTGGAGG - Exonic
907043913 1:51288056-51288078 CCTGCCCTGCCCTGCCTTTGGGG - Exonic
907522493 1:55033341-55033363 CCAGCCCAGCTCTTCCTTGCAGG + Intergenic
908143145 1:61209000-61209022 CATTCCCAGCGCTGCCTGGGAGG + Intronic
910392176 1:86756771-86756793 ACTGCCTAGAGCTGCCTTGGGGG - Intergenic
916746027 1:167685476-167685498 CTGGCCCAGGTCTACCTTGGGGG - Exonic
920683465 1:208090854-208090876 CCTGCCCAGGCCTCCCATGGTGG + Intronic
924494657 1:244575436-244575458 CCTGCTCAGCTCTAACTTGCAGG + Intronic
924552505 1:245091545-245091567 CCTCCCCAGCCCCACCTTCGAGG + Intronic
1067110570 10:43396998-43397020 CCTAGGCAGCGCTAGCTTGGCGG - Intronic
1070518451 10:77229583-77229605 CCTGCCCAAGGCTACCTTCCTGG + Intronic
1075168593 10:120092062-120092084 ACTGCCCAGTGGTACCTGGGGGG - Intergenic
1076164308 10:128269443-128269465 CCTGCCCAGCTGCATCTTGGAGG - Intergenic
1076296832 10:129392021-129392043 AATGCCCAGCGCTCCCTGGGCGG + Intergenic
1083310089 11:61779563-61779585 CCTGCTCACCCCTACCTTGCTGG - Exonic
1083656135 11:64230618-64230640 CCTTCCCAGCGCTGGCTTCGGGG - Exonic
1084007513 11:66331176-66331198 CCTGCTCTGGGCTTCCTTGGGGG + Intronic
1089370312 11:117950850-117950872 CCTGTCCAGAGCTACTGTGGTGG + Intergenic
1090398951 11:126436187-126436209 TTTGCCCAGCGCTGCCTTTGAGG + Intronic
1091980163 12:4858243-4858265 CCAGCCCAGCCCTCCCTTGCTGG - Intergenic
1096591221 12:52660370-52660392 CCTGCCCTGCTCTACCCTGGTGG + Intergenic
1096638443 12:52975855-52975877 CCTGTCCTGTGCTACCTGGGAGG + Intergenic
1096776406 12:53966948-53966970 CATCCCCAGTGCTACCCTGGAGG - Intergenic
1103738375 12:123075391-123075413 CCTGCCCAGCACAGCCTGGGTGG + Intronic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1105024872 12:132841327-132841349 CCTGCCCAGCGCTCACCAGGAGG + Exonic
1106553087 13:30788245-30788267 CCTGCCCACCGCTTCCCTGTCGG - Intergenic
1113769471 13:112898952-112898974 CCTGCCCGGTGCTCCCTGGGAGG - Intronic
1119215868 14:72868636-72868658 ACTGCTCAGTGCTACCTGGGAGG + Intronic
1119407797 14:74409600-74409622 CAGGCCCAGCGCCACCTAGGAGG + Exonic
1119880023 14:78092483-78092505 CCTCACCAGGGCCACCTTGGGGG + Intergenic
1122575559 14:102739420-102739442 CCTGCCCAAAGCTACATTGCAGG - Intergenic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1122816122 14:104314912-104314934 CCTGCCCAGCCCTGCCTCTGGGG + Intergenic
1123042979 14:105498003-105498025 CCAGCCCAGCCCCACCTTCGGGG + Intronic
1123085059 14:105713427-105713449 CCTGTCCAGCGCTGCCCAGGTGG + Intergenic
1125492319 15:40157580-40157602 CCCGCCCAGAGCAACTTTGGAGG - Intergenic
1128350026 15:66882272-66882294 TCTGGCCAGCCCCACCTTGGGGG + Intergenic
1129190839 15:73936757-73936779 CCTGCCCAGCGGTTCCTGGAGGG - Intronic
1130973819 15:88757443-88757465 CATGCCCAGCATTACCCTGGTGG - Intergenic
1131121030 15:89823524-89823546 CCTGCCCTGCCCTGCCCTGGGGG - Intergenic
1132348567 15:101123030-101123052 GCTGCCCAGCCCCAGCTTGGTGG - Intergenic
1133011165 16:2912420-2912442 CCCGCCCAGCGCTGCCTTCCTGG + Intronic
1136398384 16:30005127-30005149 CCTCCCCAGAGCTGCCCTGGGGG + Intronic
1138126414 16:54442564-54442586 CATGAACATCGCTACCTTGGGGG + Intergenic
1138654351 16:58482142-58482164 CCTAGCCAGCTCTACCCTGGGGG - Intronic
1142206039 16:88783849-88783871 CTCGCCCAGCGCTAGCTTTGGGG - Intronic
1142717029 17:1752814-1752836 CCTGCCCAGCCTGACCTCGGGGG - Intronic
1143388086 17:6543845-6543867 CCTGCCCACCCCTTCCTTGGAGG - Intronic
1150133608 17:62682184-62682206 CCTGCCCTGCTCTGCCCTGGGGG + Intronic
1152151560 17:78604362-78604384 CCTCCCCAGCGCCAGCCTGGTGG + Intergenic
1155169408 18:23256232-23256254 CCTGTCCATCCCCACCTTGGTGG + Intronic
1157046048 18:44103071-44103093 CCTGCCTAGCGTTGCATTGGAGG + Intergenic
1158865299 18:61632562-61632584 CCTGCACAGCTCAACCTGGGAGG - Intergenic
1160774413 19:848428-848450 CCTGCCCAGGGCCACCCTGATGG - Intergenic
1162328511 19:10012428-10012450 CCTGCCCTGCCCTGCCTTGCTGG + Intergenic
1163556710 19:17997420-17997442 CATGCCCAGAGCTGCCCTGGGGG - Intronic
1165365564 19:35362888-35362910 CCTGCCCAGGGGTACATTGAGGG + Intergenic
926138266 2:10352703-10352725 CCTCCCCAGCTCTCCCTGGGGGG - Intronic
927980105 2:27369827-27369849 CCTGCCAAGCGCTACGCAGGAGG - Intronic
932343069 2:70978859-70978881 CCGGCCCAGCGCCTCCCTGGTGG + Intronic
932492580 2:72131558-72131580 CCTGCCCAGGGCCACCAGGGAGG + Exonic
934863896 2:97788704-97788726 TCTGCCCAGCGCTGCCTTACTGG + Intronic
937230825 2:120397164-120397186 CCTGCCCTGCCCTGCCCTGGGGG + Intergenic
939839790 2:147173130-147173152 CCTGCCCAGCCCTGCCTTGCTGG + Intergenic
945236171 2:207633617-207633639 ACTGCTCAGCGCTACCTTGAGGG + Intergenic
946416660 2:219543436-219543458 CCTGCTCAGCGTCACCTGGGTGG - Exonic
947115075 2:226761163-226761185 CCTGCCCACAGCTACTTAGGTGG - Intronic
948554255 2:238796394-238796416 CCTGCCCAGCACTGCCTGTGTGG + Intergenic
948620333 2:239230589-239230611 CCTGCCCAGTCCTTCCGTGGGGG + Intronic
1174130909 20:48342755-48342777 CCTCCCCAGGGCTGCCTTCGAGG - Intergenic
1175550378 20:59813691-59813713 CCTTCCCAGGACTACCCTGGGGG + Intronic
1175553251 20:59830568-59830590 CCTGCCCAGCGCCTCCTTGCAGG - Intronic
1175801689 20:61804615-61804637 CCTGCCCAGCTCTCGCCTGGTGG + Intronic
1178590983 21:33909911-33909933 CCTCCGCACCGCTCCCTTGGAGG + Intronic
1179572765 21:42287549-42287571 CCTTCCCAGCTCCACCTTGGAGG + Intronic
1181013074 22:20053579-20053601 TCTGCCCAGCACTGCCTCGGGGG + Intronic
1184415386 22:44349176-44349198 ACTGCCCATCGCTCCCTGGGGGG + Intergenic
1184453552 22:44596871-44596893 CCTGCCCTGCGCTGCTGTGGTGG - Intergenic
1185334099 22:50263821-50263843 CCTGCCCAGAGCTGAGTTGGGGG - Exonic
950451141 3:13066569-13066591 CCTGCCCAGCCCTGCCTGGAAGG - Intronic
951036460 3:17938320-17938342 CCTGCCCTGCTCTACCAAGGGGG + Intronic
952406328 3:33008410-33008432 CCTGCCCAGTGGTATCTAGGAGG - Intronic
954439494 3:50513975-50513997 CCTCCCCAGAGATACCTTGGTGG - Intergenic
962637433 3:137345556-137345578 CCTGCCCAGGGCTGTCTGGGAGG + Intergenic
968935771 4:3609608-3609630 GCTGCCCAGCCCTACCCTGGGGG + Intergenic
969528945 4:7719304-7719326 CTTGCCCAGCGCCTCCGTGGCGG + Intronic
971252062 4:24981234-24981256 CCTGCCAAGCTCTTCCTTGGGGG - Intergenic
986707230 5:10462096-10462118 TCAGCCCAGCCCAACCTTGGAGG - Intronic
989133769 5:38133283-38133305 CCTGCACAGCACTGCCTTGTCGG + Intergenic
989379185 5:40797638-40797660 CCAGCCCATCGCTTCCTTGGCGG - Intronic
993385028 5:87252526-87252548 CCTGCAGCCCGCTACCTTGGGGG - Intergenic
994314130 5:98312819-98312841 CCTGGGCAGCCCTGCCTTGGGGG - Intergenic
997309229 5:132866274-132866296 CCTGGCCAGCGCTGCCCCGGAGG + Intronic
997964599 5:138347221-138347243 CCTGCCCATTGCTCTCTTGGTGG - Exonic
998097308 5:139403511-139403533 CCTTGCCAGCGCTAACTTAGGGG - Intronic
1002828696 6:798495-798517 CCTGCCCAGCGGCAGCTTGCAGG - Intergenic
1003078209 6:3000407-3000429 GCTGCCCAGCGCTGCCCTGAAGG + Intronic
1003869485 6:10390644-10390666 CCTGCCCAACGCAACCTTTTAGG - Intergenic
1006902962 6:37514908-37514930 CCAGGCCAGGGCTATCTTGGCGG + Intergenic
1006906241 6:37535695-37535717 CCTGCCCAGGGCCTCCTGGGGGG - Intergenic
1007762000 6:44138753-44138775 CCTGCCCTGCCCCACCTTGAGGG + Intronic
1013482200 6:110562396-110562418 CAACCCCAGCGCCACCTTGGTGG + Intergenic
1017516890 6:155164542-155164564 CCTGCCGAGGGCCAGCTTGGAGG - Exonic
1017580086 6:155854995-155855017 CCTGCCCCGCATTCCCTTGGGGG - Intergenic
1018964712 6:168475542-168475564 CATGGCCAGCGTTGCCTTGGGGG + Intronic
1019151221 6:170007234-170007256 GCTGCCCAGGGCTGCCTCGGTGG - Intergenic
1019342000 7:512778-512800 CCTCACCTGGGCTACCTTGGAGG - Intronic
1021500895 7:21330562-21330584 CAGGCCCAGCGCCACCTCGGAGG + Intergenic
1022655914 7:32319275-32319297 CCTGCCCAGCCCTTTCATGGCGG + Intergenic
1025928955 7:65980090-65980112 CCTGCCCTGCCCTGCCCTGGGGG - Intronic
1026087017 7:67270938-67270960 CCTGCTGAGGGCTGCCTTGGGGG + Intergenic
1026690084 7:72543760-72543782 CCTGCTGAGGGCTGCCTTGGGGG - Intergenic
1026858259 7:73769055-73769077 CCTGCCCAGCGCGAGCATGGGGG + Exonic
1027269805 7:76513156-76513178 CCTGCCCAGCGCTACCTTGGTGG - Intronic
1035924375 8:3711346-3711368 TCTGGCCAGCCCTTCCTTGGAGG - Intronic
1036656765 8:10681947-10681969 CCTGCCCACAGCAGCCTTGGCGG + Intronic
1039414997 8:37386138-37386160 CCTGGCCAGCCCTCCCTTAGGGG + Intergenic
1039981269 8:42411464-42411486 CCTGCCCAGCCCGACATTGCTGG - Intergenic
1040292272 8:46131596-46131618 CCTGCCCAGGACAACCCTGGGGG + Intergenic
1040304525 8:46205156-46205178 TCTGCCCAGCACAGCCTTGGGGG - Intergenic
1040312349 8:46243302-46243324 CCTGCCCAGCGCAGCCCTGGGGG - Intergenic
1044420850 8:91994131-91994153 CCTGGCCACCACTCCCTTGGGGG - Intronic
1051041516 9:12817956-12817978 CGTGCCCAGCGCTCCCACGGTGG + Intronic
1051936428 9:22447475-22447497 CCTGCGCAGCGCCACCTGGGCGG - Exonic
1054454414 9:65422270-65422292 GCTGCCCAGCCCTACCCTGGGGG - Intergenic
1058785055 9:108378783-108378805 TCTGCCCAGCTCTACCTTCCTGG - Intergenic
1060280093 9:122209831-122209853 CTTGCCCAGGGCTACCCAGGAGG - Intronic
1061059492 9:128243456-128243478 CCTGCCCAGGACAAACTTGGAGG - Intronic
1061187457 9:129063185-129063207 CCTGCCCAGCGATGCCCCGGGGG - Intronic
1061609311 9:131735766-131735788 CCTGCCCATAGCTGCCTTGTAGG + Intronic
1062609397 9:137367208-137367230 CCTGCCCAGCAGTGCCTTGGGGG + Intronic
1062717784 9:138019650-138019672 CCTGCCCAGTGCTTCCTTGCTGG + Intronic
1186777536 X:12880530-12880552 TCTGCCCAGGGATTCCTTGGGGG - Intronic
1192360134 X:70434138-70434160 CCGGCCCAGCCTTCCCTTGGAGG + Intergenic
1199920835 X:152401725-152401747 CCAGCCCTGTGCTACATTGGAGG - Intronic