ID: 1027273809

View in Genome Browser
Species Human (GRCh38)
Location 7:76539248-76539270
Sequence TTGTGCTTCTAGAAGAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85959
Summary {0: 8, 1: 0, 2: 152, 3: 5593, 4: 80206}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027273799_1027273809 28 Left 1027273799 7:76539197-76539219 CCTCCCAAGTAGCTGGGATTACA 0: 48952
1: 142577
2: 242332
3: 522592
4: 386712
Right 1027273809 7:76539248-76539270 TTGTGCTTCTAGAAGAGACAGGG 0: 8
1: 0
2: 152
3: 5593
4: 80206
1027273801_1027273809 25 Left 1027273801 7:76539200-76539222 CCCAAGTAGCTGGGATTACAGGT 0: 15366
1: 98640
2: 233329
3: 337639
4: 469862
Right 1027273809 7:76539248-76539270 TTGTGCTTCTAGAAGAGACAGGG 0: 8
1: 0
2: 152
3: 5593
4: 80206
1027273802_1027273809 24 Left 1027273802 7:76539201-76539223 CCAAGTAGCTGGGATTACAGGTG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720
Right 1027273809 7:76539248-76539270 TTGTGCTTCTAGAAGAGACAGGG 0: 8
1: 0
2: 152
3: 5593
4: 80206
1027273805_1027273809 -3 Left 1027273805 7:76539228-76539250 CCAGAACGCCCAGCTCATTTTTG No data
Right 1027273809 7:76539248-76539270 TTGTGCTTCTAGAAGAGACAGGG 0: 8
1: 0
2: 152
3: 5593
4: 80206
1027273804_1027273809 0 Left 1027273804 7:76539225-76539247 CCACCAGAACGCCCAGCTCATTT No data
Right 1027273809 7:76539248-76539270 TTGTGCTTCTAGAAGAGACAGGG 0: 8
1: 0
2: 152
3: 5593
4: 80206
1027273803_1027273809 1 Left 1027273803 7:76539224-76539246 CCCACCAGAACGCCCAGCTCATT No data
Right 1027273809 7:76539248-76539270 TTGTGCTTCTAGAAGAGACAGGG 0: 8
1: 0
2: 152
3: 5593
4: 80206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027273809 Original CRISPR TTGTGCTTCTAGAAGAGACA GGG Intergenic
Too many off-targets to display for this crispr