ID: 1027278071

View in Genome Browser
Species Human (GRCh38)
Location 7:76582995-76583017
Sequence AAACCTCTTGCTAAAGCCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027278071_1027278072 -3 Left 1027278071 7:76582995-76583017 CCGTTGGCTTTAGCAAGAGGTTT No data
Right 1027278072 7:76583015-76583037 TTTAGTCCTGTAAACTCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027278071 Original CRISPR AAACCTCTTGCTAAAGCCAA CGG (reversed) Intergenic
No off target data available for this crispr