ID: 1027278072

View in Genome Browser
Species Human (GRCh38)
Location 7:76583015-76583037
Sequence TTTAGTCCTGTAAACTCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027278071_1027278072 -3 Left 1027278071 7:76582995-76583017 CCGTTGGCTTTAGCAAGAGGTTT No data
Right 1027278072 7:76583015-76583037 TTTAGTCCTGTAAACTCCAAAGG No data
1027278070_1027278072 -2 Left 1027278070 7:76582994-76583016 CCCGTTGGCTTTAGCAAGAGGTT No data
Right 1027278072 7:76583015-76583037 TTTAGTCCTGTAAACTCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027278072 Original CRISPR TTTAGTCCTGTAAACTCCAA AGG Intergenic
No off target data available for this crispr