ID: 1027282244

View in Genome Browser
Species Human (GRCh38)
Location 7:76617286-76617308
Sequence AACCACTTACCAGTACTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 2, 1: 0, 2: 0, 3: 3, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027282241_1027282244 9 Left 1027282241 7:76617254-76617276 CCGCACCAGGCAATTTACTTCTA 0: 2
1: 0
2: 2
3: 23
4: 299
Right 1027282244 7:76617286-76617308 AACCACTTACCAGTACTTCCTGG 0: 2
1: 0
2: 0
3: 3
4: 78
1027282240_1027282244 12 Left 1027282240 7:76617251-76617273 CCACCGCACCAGGCAATTTACTT 0: 2
1: 0
2: 9
3: 91
4: 1112
Right 1027282244 7:76617286-76617308 AACCACTTACCAGTACTTCCTGG 0: 2
1: 0
2: 0
3: 3
4: 78
1027282242_1027282244 4 Left 1027282242 7:76617259-76617281 CCAGGCAATTTACTTCTAACCAC 0: 2
1: 0
2: 1
3: 9
4: 103
Right 1027282244 7:76617286-76617308 AACCACTTACCAGTACTTCCTGG 0: 2
1: 0
2: 0
3: 3
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027282244 Original CRISPR AACCACTTACCAGTACTTCC TGG Intronic
901759614 1:11462173-11462195 AACCTTATACCAGTCCTTCCAGG - Intergenic
907934342 1:59028829-59028851 AATCACTTACCTTTATTTCCTGG - Intergenic
909379564 1:74982882-74982904 AACCACTAACCTATACTTTCTGG + Intergenic
916504934 1:165419953-165419975 AAGCCCTTACCAGGGCTTCCCGG - Exonic
919264371 1:195242489-195242511 AACAATTTACCATTACTTTCAGG + Intergenic
921644707 1:217600191-217600213 AAACACTGACCAGTACTTAATGG - Intronic
1079775111 11:24515466-24515488 AAGCACTTAACATTATTTCCTGG - Intronic
1086008770 11:82072843-82072865 AACCACTTACCTGTATTGACGGG - Intergenic
1086233459 11:84598228-84598250 AACCACCAACTAGTACTTGCAGG + Intronic
1091204102 11:133807694-133807716 GACCACTTTCCAGTTCTTACGGG - Intergenic
1091563111 12:1629598-1629620 CTCCACCTACCAGTCCTTCCCGG - Intronic
1095293106 12:40499013-40499035 CACCACATACCAGGACATCCTGG + Intronic
1107316014 13:39133079-39133101 TACCACTGACCAATAGTTCCTGG + Intergenic
1111396619 13:87674622-87674644 TACCACTTAGCAGCGCTTCCCGG - Intronic
1116978372 14:51141416-51141438 AACCAATTACCAATTGTTCCAGG + Intergenic
1117765305 14:59075889-59075911 ACTCTCTTACCAGTATTTCCTGG + Intergenic
1118005441 14:61561205-61561227 AAGCACTTTCCAGTTCATCCTGG + Intronic
1124073710 15:26421310-26421332 ATCCCCTTCCCAGGACTTCCTGG + Intergenic
1127672780 15:61211838-61211860 AACCTCCTTCCAGGACTTCCAGG + Intronic
1129117636 15:73374080-73374102 AACCACTTTCCATTTCCTCCAGG - Intergenic
1129542195 15:76359467-76359489 TACCACTTACCTGTATTTCTTGG - Intronic
1131457501 15:92594474-92594496 AACCATTAACCATTTCTTCCTGG - Intergenic
1131687495 15:94786082-94786104 AAACACTGACAGGTACTTCCAGG + Intergenic
1133210753 16:4262204-4262226 GCCCACTGACAAGTACTTCCAGG - Intronic
1135106549 16:19654802-19654824 CACCACTTACCAGAACTGCAAGG + Intronic
1135300090 16:21319269-21319291 ATCCAGATACCAGAACTTCCTGG - Intergenic
1142519908 17:497529-497551 AACCACTGACAAGTACGTCTGGG + Intergenic
1142970263 17:3606590-3606612 AACCACTTACTGGCACCTCCTGG + Intergenic
1146569598 17:33941198-33941220 AACCACTCACTAGGACTCCCTGG - Intronic
1157240290 18:46003148-46003170 AACCACTTTCCAGTAGTAACTGG - Intronic
1158384365 18:56972816-56972838 CACCACTCACAAGTACTTCTTGG + Intronic
1159931772 18:74319595-74319617 AACCACTACCCAGTTCTTTCTGG + Intronic
1165002868 19:32779344-32779366 AACCGCTTACTGGTACTTACAGG - Intronic
926685498 2:15694840-15694862 AAGGACTGACCAGTACTGCCTGG + Intronic
929140052 2:38659057-38659079 AAAGAGGTACCAGTACTTCCTGG - Intergenic
931306391 2:61033593-61033615 TAGCACTTACCAGTACCTTCTGG - Intronic
943114569 2:183650701-183650723 ATCTACTTACCATTAATTCCAGG + Intergenic
1170353905 20:15471257-15471279 TACCACTTATCAGTACTCCTAGG + Intronic
1172323721 20:34018097-34018119 ACCCCTTTACCAGTAATTCCTGG - Intronic
1174110940 20:48197323-48197345 CACCCCTTACCAGTACTGCCTGG + Intergenic
1177215958 21:18129282-18129304 AACCATTTACCATTACTTTGTGG + Intronic
1178078667 21:29038042-29038064 AACCACTTACCACTACCTGTAGG - Intronic
1179274037 21:39874878-39874900 AGCCACTTAGCAGCACTTTCAGG - Intronic
1179453232 21:41479859-41479881 TACCATTTACCAGCACTGCCTGG - Intronic
1182431811 22:30303444-30303466 AAGCACTTACCACCACTTCGTGG + Intronic
1184702439 22:46185063-46185085 AACCACCAACCAGTACGTTCAGG - Intronic
1184957453 22:47900291-47900313 AACCACTTTCCTTTTCTTCCAGG - Intergenic
953697690 3:45172615-45172637 CCCCACTTACCATCACTTCCAGG - Intergenic
954829922 3:53411880-53411902 TACCAATTTCCAGTTCTTCCAGG + Intergenic
956797240 3:72728133-72728155 ACTCTCTTACCAGTACTTCCTGG + Intergenic
967892005 3:194370135-194370157 AAGCACTTGCCAATACTTCTAGG - Intergenic
973560934 4:52134581-52134603 ACACGCTTACCAGTATTTCCTGG + Intergenic
975855657 4:78621810-78621832 ACTCACTTCCCAGTGCTTCCTGG + Intergenic
982520067 4:156405302-156405324 ATTCACTTACCAGTAATTACTGG - Intergenic
985107787 4:186515714-186515736 AAACACTTACCACCCCTTCCTGG - Intronic
985338309 4:188920302-188920324 AACCACTTAAAATTATTTCCTGG - Intergenic
987858786 5:23456602-23456624 AACCAATTTCGAGCACTTCCAGG + Intergenic
990786283 5:59424087-59424109 AAGCACTTAGGAGGACTTCCAGG + Intronic
993296161 5:86143983-86144005 ATCCACTTCCCTGTACTTTCAGG + Intergenic
995487982 5:112658189-112658211 ACTCACCTACCAGTGCTTCCTGG + Intergenic
1001036962 5:168303846-168303868 AACCACCTCCCTGCACTTCCTGG - Intronic
1001868696 5:175131242-175131264 AAAAAGTTACCAGTATTTCCAGG + Intergenic
1002849426 6:980190-980212 AACCACTTAAGAGTCCTTCATGG + Intergenic
1009944253 6:70324398-70324420 ACCCTCTTACCTGCACTTCCAGG - Intergenic
1018731402 6:166654117-166654139 AAACACTTACCTATACTTCAGGG + Intronic
1018904225 6:168065689-168065711 AACCACATACCAGTGTCTCCAGG + Intronic
1027256652 7:76435032-76435054 AACCACTTACCAGTACTTCCCGG - Intronic
1027282244 7:76617286-76617308 AACCACTTACCAGTACTTCCTGG + Intronic
1027741477 7:82012144-82012166 AACCTCTTACCAATGCATCCAGG + Exonic
1028710014 7:93896145-93896167 AACCACTTTTCTCTACTTCCTGG + Intronic
1032270494 7:130400207-130400229 AACCAGTAATCAGTCCTTCCGGG + Exonic
1034808301 7:154107785-154107807 AACCCCTCACCAGCACTTCTGGG - Intronic
1041480447 8:58314547-58314569 GACCACTTCTCAGTTCTTCCAGG + Intergenic
1043528749 8:81126462-81126484 AACCAATTTCCAGTCCTTCTGGG + Intergenic
1047140038 8:122128074-122128096 AAGGACTTACCAGTACATCCAGG + Intergenic
1047275386 8:123401570-123401592 AACCACATGCCATCACTTCCTGG - Intronic
1047555996 8:125931026-125931048 AAGCAGTTACCAGTCCTGCCAGG - Intergenic
1050996318 9:12222521-12222543 AACCACATATTATTACTTCCAGG + Intergenic
1058400993 9:104619085-104619107 TTCCACTTACCTGTACATCCTGG + Intergenic
1060931656 9:127492885-127492907 AAACACATACCAGGATTTCCCGG - Exonic
1188020421 X:25151149-25151171 AACCACATACCAGGACATCATGG - Intergenic
1193883972 X:86962215-86962237 GAGCACTTACCAGAACTTGCTGG - Intergenic
1196292961 X:113965530-113965552 GACCACTTCCCAGTGTTTCCCGG + Intergenic