ID: 1027290469

View in Genome Browser
Species Human (GRCh38)
Location 7:76703803-76703825
Sequence CTGCTTCCACTGATTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027290469_1027290473 7 Left 1027290469 7:76703803-76703825 CCTTCCACAATCAGTGGAAGCAG No data
Right 1027290473 7:76703833-76703855 CCTTCACTAGAAGCAGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027290469 Original CRISPR CTGCTTCCACTGATTGTGGA AGG (reversed) Intergenic
No off target data available for this crispr