ID: 1027290847

View in Genome Browser
Species Human (GRCh38)
Location 7:76708742-76708764
Sequence CAGGTTACACTGTTCTGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027290847_1027290851 3 Left 1027290847 7:76708742-76708764 CCATGTCAGAACAGTGTAACCTG No data
Right 1027290851 7:76708768-76708790 GTACAAGGAAAAGGACCTGCAGG No data
1027290847_1027290849 -6 Left 1027290847 7:76708742-76708764 CCATGTCAGAACAGTGTAACCTG No data
Right 1027290849 7:76708759-76708781 AACCTGTTTGTACAAGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027290847 Original CRISPR CAGGTTACACTGTTCTGACA TGG (reversed) Intergenic
No off target data available for this crispr