ID: 1027298114

View in Genome Browser
Species Human (GRCh38)
Location 7:76799554-76799576
Sequence TAGGGTCCACCACCTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027298114_1027298123 30 Left 1027298114 7:76799554-76799576 CCCAGCTCAGGTGGTGGACCCTA No data
Right 1027298123 7:76799607-76799629 AAGATTTCACATTTAAGCCATGG No data
1027298114_1027298118 -2 Left 1027298114 7:76799554-76799576 CCCAGCTCAGGTGGTGGACCCTA No data
Right 1027298118 7:76799575-76799597 TACTTAGCCTAAACCTGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027298114 Original CRISPR TAGGGTCCACCACCTGAGCT GGG (reversed) Intergenic
No off target data available for this crispr