ID: 1027298265

View in Genome Browser
Species Human (GRCh38)
Location 7:76801383-76801405
Sequence GTATGCTCAAAGTGTCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027298265_1027298267 -6 Left 1027298265 7:76801383-76801405 CCCTGCAGACACTTTGAGCATAC No data
Right 1027298267 7:76801400-76801422 GCATACCATCCCTATCATCTTGG No data
1027298265_1027298271 12 Left 1027298265 7:76801383-76801405 CCCTGCAGACACTTTGAGCATAC No data
Right 1027298271 7:76801418-76801440 CTTGGAGAGTAGATGTAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027298265 Original CRISPR GTATGCTCAAAGTGTCTGCA GGG (reversed) Intergenic
No off target data available for this crispr