ID: 1027303697

View in Genome Browser
Species Human (GRCh38)
Location 7:76869322-76869344
Sequence TGCCGAAGGCCAGTGGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027303689_1027303697 5 Left 1027303689 7:76869294-76869316 CCCCAGGAACAGGTGCTTTAAAT No data
Right 1027303697 7:76869322-76869344 TGCCGAAGGCCAGTGGGGCCTGG No data
1027303691_1027303697 3 Left 1027303691 7:76869296-76869318 CCAGGAACAGGTGCTTTAAATTA No data
Right 1027303697 7:76869322-76869344 TGCCGAAGGCCAGTGGGGCCTGG No data
1027303685_1027303697 15 Left 1027303685 7:76869284-76869306 CCCCTTCAAACCCCAGGAACAGG No data
Right 1027303697 7:76869322-76869344 TGCCGAAGGCCAGTGGGGCCTGG No data
1027303690_1027303697 4 Left 1027303690 7:76869295-76869317 CCCAGGAACAGGTGCTTTAAATT No data
Right 1027303697 7:76869322-76869344 TGCCGAAGGCCAGTGGGGCCTGG No data
1027303687_1027303697 14 Left 1027303687 7:76869285-76869307 CCCTTCAAACCCCAGGAACAGGT No data
Right 1027303697 7:76869322-76869344 TGCCGAAGGCCAGTGGGGCCTGG No data
1027303688_1027303697 13 Left 1027303688 7:76869286-76869308 CCTTCAAACCCCAGGAACAGGTG No data
Right 1027303697 7:76869322-76869344 TGCCGAAGGCCAGTGGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027303697 Original CRISPR TGCCGAAGGCCAGTGGGGCC TGG Intergenic
No off target data available for this crispr