ID: 1027308962 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:76934401-76934423 |
| Sequence | AAGCAGTTATTTGTTGGTAA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1027308962_1027308966 | 11 | Left | 1027308962 | 7:76934401-76934423 | CCATTACCAACAAATAACTGCTT | No data | ||
| Right | 1027308966 | 7:76934435-76934457 | ATACAACAAAGCACCACACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1027308962 | Original CRISPR | AAGCAGTTATTTGTTGGTAA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||