ID: 1027308962

View in Genome Browser
Species Human (GRCh38)
Location 7:76934401-76934423
Sequence AAGCAGTTATTTGTTGGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027308962_1027308966 11 Left 1027308962 7:76934401-76934423 CCATTACCAACAAATAACTGCTT No data
Right 1027308966 7:76934435-76934457 ATACAACAAAGCACCACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027308962 Original CRISPR AAGCAGTTATTTGTTGGTAA TGG (reversed) Intergenic
No off target data available for this crispr