ID: 1027312010

View in Genome Browser
Species Human (GRCh38)
Location 7:76960200-76960222
Sequence GACAGGGTGCCGGGTGCGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027312005_1027312010 -6 Left 1027312005 7:76960183-76960205 CCGGCAGCTTTGGACGGGACAGG 0: 2
1: 0
2: 0
3: 3
4: 126
Right 1027312010 7:76960200-76960222 GACAGGGTGCCGGGTGCGAAAGG No data
1027311997_1027312010 27 Left 1027311997 7:76960150-76960172 CCTGAGGGCGAGAGTTGGGGGAC 0: 2
1: 1
2: 2
3: 17
4: 212
Right 1027312010 7:76960200-76960222 GACAGGGTGCCGGGTGCGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027312010 Original CRISPR GACAGGGTGCCGGGTGCGAA AGG Intergenic
No off target data available for this crispr