ID: 1027312125

View in Genome Browser
Species Human (GRCh38)
Location 7:76960744-76960766
Sequence CCATCCGGGCTTAAGCCATC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027312117_1027312125 21 Left 1027312117 7:76960700-76960722 CCTAGCTCCTCTAGCGCTCTAGA 0: 2
1: 0
2: 0
3: 0
4: 75
Right 1027312125 7:76960744-76960766 CCATCCGGGCTTAAGCCATCCGG No data
1027312119_1027312125 14 Left 1027312119 7:76960707-76960729 CCTCTAGCGCTCTAGAAGGTAGA 0: 2
1: 0
2: 0
3: 2
4: 51
Right 1027312125 7:76960744-76960766 CCATCCGGGCTTAAGCCATCCGG No data
1027312116_1027312125 25 Left 1027312116 7:76960696-76960718 CCTTCCTAGCTCCTCTAGCGCTC 0: 2
1: 0
2: 0
3: 7
4: 131
Right 1027312125 7:76960744-76960766 CCATCCGGGCTTAAGCCATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027312125 Original CRISPR CCATCCGGGCTTAAGCCATC CGG Intergenic
No off target data available for this crispr