ID: 1027312642

View in Genome Browser
Species Human (GRCh38)
Location 7:76964151-76964173
Sequence GGGGAAAAGGAGAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027312636_1027312642 -4 Left 1027312636 7:76964132-76964154 CCGCCTGGGGGAAATCCAGGGGG 0: 2
1: 0
2: 1
3: 13
4: 144
Right 1027312642 7:76964151-76964173 GGGGAAAAGGAGAATGAGGAAGG No data
1027312638_1027312642 -7 Left 1027312638 7:76964135-76964157 CCTGGGGGAAATCCAGGGGGAAA 0: 2
1: 0
2: 3
3: 21
4: 247
Right 1027312642 7:76964151-76964173 GGGGAAAAGGAGAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027312642 Original CRISPR GGGGAAAAGGAGAATGAGGA AGG Intergenic
No off target data available for this crispr