ID: 1027313515

View in Genome Browser
Species Human (GRCh38)
Location 7:76970263-76970285
Sequence CTGTTGTCAGGGAGGTGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027313506_1027313515 12 Left 1027313506 7:76970228-76970250 CCATTTTTGTGGAGCTCGGGGAT 0: 2
1: 0
2: 0
3: 9
4: 72
Right 1027313515 7:76970263-76970285 CTGTTGTCAGGGAGGTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027313515 Original CRISPR CTGTTGTCAGGGAGGTGCCA TGG Intergenic
No off target data available for this crispr