ID: 1027314229

View in Genome Browser
Species Human (GRCh38)
Location 7:76975450-76975472
Sequence CCACCCTTTCAGTCTCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 2, 1: 0, 2: 1, 3: 7, 4: 114}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027314229_1027314234 -10 Left 1027314229 7:76975450-76975472 CCTCCTTGAGACTGAAAGGGTGG 0: 2
1: 0
2: 1
3: 7
4: 114
Right 1027314234 7:76975463-76975485 GAAAGGGTGGGCAAGTGCTAGGG No data
1027314229_1027314236 -4 Left 1027314229 7:76975450-76975472 CCTCCTTGAGACTGAAAGGGTGG 0: 2
1: 0
2: 1
3: 7
4: 114
Right 1027314236 7:76975469-76975491 GTGGGCAAGTGCTAGGGGTGAGG No data
1027314229_1027314245 25 Left 1027314229 7:76975450-76975472 CCTCCTTGAGACTGAAAGGGTGG 0: 2
1: 0
2: 1
3: 7
4: 114
Right 1027314245 7:76975498-76975520 GAGAGGCAGGGAGGCCAAGATGG No data
1027314229_1027314237 -3 Left 1027314229 7:76975450-76975472 CCTCCTTGAGACTGAAAGGGTGG 0: 2
1: 0
2: 1
3: 7
4: 114
Right 1027314237 7:76975470-76975492 TGGGCAAGTGCTAGGGGTGAGGG No data
1027314229_1027314242 13 Left 1027314229 7:76975450-76975472 CCTCCTTGAGACTGAAAGGGTGG 0: 2
1: 0
2: 1
3: 7
4: 114
Right 1027314242 7:76975486-76975508 GTGAGGGGCCAGGAGAGGCAGGG No data
1027314229_1027314246 26 Left 1027314229 7:76975450-76975472 CCTCCTTGAGACTGAAAGGGTGG 0: 2
1: 0
2: 1
3: 7
4: 114
Right 1027314246 7:76975499-76975521 AGAGGCAGGGAGGCCAAGATGGG No data
1027314229_1027314238 -2 Left 1027314229 7:76975450-76975472 CCTCCTTGAGACTGAAAGGGTGG 0: 2
1: 0
2: 1
3: 7
4: 114
Right 1027314238 7:76975471-76975493 GGGCAAGTGCTAGGGGTGAGGGG No data
1027314229_1027314240 8 Left 1027314229 7:76975450-76975472 CCTCCTTGAGACTGAAAGGGTGG 0: 2
1: 0
2: 1
3: 7
4: 114
Right 1027314240 7:76975481-76975503 TAGGGGTGAGGGGCCAGGAGAGG No data
1027314229_1027314241 12 Left 1027314229 7:76975450-76975472 CCTCCTTGAGACTGAAAGGGTGG 0: 2
1: 0
2: 1
3: 7
4: 114
Right 1027314241 7:76975485-76975507 GGTGAGGGGCCAGGAGAGGCAGG No data
1027314229_1027314243 16 Left 1027314229 7:76975450-76975472 CCTCCTTGAGACTGAAAGGGTGG 0: 2
1: 0
2: 1
3: 7
4: 114
Right 1027314243 7:76975489-76975511 AGGGGCCAGGAGAGGCAGGGAGG No data
1027314229_1027314239 3 Left 1027314229 7:76975450-76975472 CCTCCTTGAGACTGAAAGGGTGG 0: 2
1: 0
2: 1
3: 7
4: 114
Right 1027314239 7:76975476-76975498 AGTGCTAGGGGTGAGGGGCCAGG No data
1027314229_1027314235 -9 Left 1027314229 7:76975450-76975472 CCTCCTTGAGACTGAAAGGGTGG 0: 2
1: 0
2: 1
3: 7
4: 114
Right 1027314235 7:76975464-76975486 AAAGGGTGGGCAAGTGCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027314229 Original CRISPR CCACCCTTTCAGTCTCAAGG AGG (reversed) Intergenic
905036904 1:34924594-34924616 CCAGAATTTCAGGCTCAAGGTGG - Intronic
907604522 1:55803529-55803551 CAAGGCTTTCAGGCTCAAGGAGG - Intergenic
907724355 1:57005015-57005037 CCAGACTTTCAGACTCAAAGTGG - Intronic
911461052 1:98191705-98191727 AGCCCCTTTCAGTCTCAAAGTGG + Intergenic
915115772 1:153598618-153598640 CCACCACTTCAGTCCCAAGAGGG + Intergenic
918338662 1:183548247-183548269 CTACCATTTAAGTCTCCAGGGGG - Intronic
923559111 1:235025085-235025107 CCACCCTTTGAGTATTAAGGAGG + Intergenic
1072040535 10:91602089-91602111 CCACCCTTCAAATCCCAAGGTGG + Intergenic
1075348096 10:121699151-121699173 CCACCCTCTCAGCCTGACGGAGG - Intergenic
1081430988 11:42976471-42976493 CCCCCATCTCAGCCTCAAGGAGG - Intergenic
1083611467 11:64006418-64006440 CCACCCTCTCGGTGCCAAGGCGG + Intronic
1087370189 11:97274094-97274116 CCAGGTTTTCAGTCTCCAGGTGG - Intergenic
1088712679 11:112522860-112522882 CCACCTTCTCACTCTTAAGGAGG + Intergenic
1088778803 11:113113608-113113630 CCACCCTATCAGGCTCTAGATGG - Intronic
1093194336 12:16112302-16112324 CCAGCCTCTCAGGCTCCAGGGGG - Intergenic
1095792061 12:46178383-46178405 CCACCCTGTCTGGCTCAGGGGGG - Intergenic
1097287282 12:57888071-57888093 CCAGCCTTTCATGCTCAGGGTGG - Intergenic
1102426299 12:112846860-112846882 CCATTCTTTCCGTCTCATGGAGG + Intronic
1103832555 12:123791356-123791378 TCACCTTTTCAGTCTCATGCAGG + Intronic
1104631770 12:130408669-130408691 CCACCCCTTCAGTCTGACAGGGG - Intronic
1109300241 13:60583682-60583704 ATTCCCTTTCAGTCTCTAGGAGG - Intergenic
1111439202 13:88257045-88257067 CCACCCTCTGTGTCTCAAAGTGG - Intergenic
1113004874 13:105688977-105688999 CCAGCATTTCAGTGTGAAGGAGG - Intergenic
1113361475 13:109635224-109635246 CCATCCTTTCCATCCCAAGGTGG + Intergenic
1115265421 14:31494937-31494959 CCACCCCTTCTGTCCCAGGGAGG - Intronic
1117974291 14:61281782-61281804 CCCAGCTTTCAGTCTCAAGTTGG + Exonic
1118960763 14:70528788-70528810 CCATTCTGTCAGACTCAAGGAGG - Intronic
1119196709 14:72722638-72722660 TCACCCCTTCAGGCTCTAGGCGG - Intronic
1122206082 14:100148692-100148714 ACACCCTGTCAGTATCATGGCGG + Intronic
1123835167 15:24182511-24182533 CCACCATTACAGTATCAAAGAGG - Intergenic
1123870889 15:24571406-24571428 CCACCGTTACAGTATCAAAGAGG - Intergenic
1127717281 15:61661538-61661560 CCAGCCCTTCAATCTAAAGGAGG - Intergenic
1127789109 15:62382522-62382544 CCAGCCTTTCAGTCTCATGGTGG + Intergenic
1127838976 15:62813501-62813523 GGATCTTTTCAGTCTCAAGGGGG - Intronic
1133597271 16:7304598-7304620 CCACCCTTTCCATCGCAACGCGG - Intronic
1137033497 16:35547050-35547072 CCACCCTTTCTGGCTCAACCCGG + Intergenic
1137272607 16:46912203-46912225 CAATCCCTTCAGTCTCAAGTTGG - Intronic
1137762473 16:50951531-50951553 CCAGCCTTTCAGGTTCAAGTGGG + Intergenic
1139697771 16:68687452-68687474 CCACCCAGTCAGCCTCAGGGGGG - Intronic
1142283154 16:89159995-89160017 TCACCCTGGGAGTCTCAAGGAGG + Intergenic
1143776747 17:9204585-9204607 CAACCCTTTCAGTTCCAAGGGGG + Intronic
1145691801 17:26749329-26749351 ACACACTTTCATTCCCAAGGTGG - Intergenic
1146366559 17:32233499-32233521 TCATCCTTTAGGTCTCAAGGAGG + Intronic
1146451367 17:32976757-32976779 CCACCCATTCAGCCTCTATGTGG + Intronic
1149313413 17:55417943-55417965 CTACCCCTCCAGTCTCAGGGTGG + Intronic
1152343416 17:79737683-79737705 CCACCTTGTCAGTTTCCAGGTGG - Intronic
1157793827 18:50557635-50557657 CCACCCTTTCTGTTCCCAGGAGG - Intergenic
1160521150 18:79508899-79508921 CCTCCCTTTCTCTCTCATGGCGG + Intronic
1162519973 19:11173997-11174019 CCACCCTTCCAGTCTGATGGGGG - Intronic
1164235464 19:23328874-23328896 CCAGCATTCCAGTCTCAATGAGG - Intronic
1164237607 19:23350760-23350782 CCTCCCTCTCAGTCTTCAGGTGG - Intronic
1165105390 19:33466593-33466615 CCAGCCTTTCAGTATCTGGGGGG + Intronic
926596027 2:14790597-14790619 CCACTCTTTCAATCTCATGAAGG + Intergenic
929544125 2:42844644-42844666 CCACCCATTCAGGCACGAGGGGG - Intergenic
934576619 2:95405782-95405804 CCACCCTCTCAGTGGCAAGAAGG + Exonic
934638841 2:96013950-96013972 CCACCCTCTCAGTGGCAAGAAGG + Intergenic
934792089 2:97070051-97070073 CCATCTTTTCAGTGTCATGGAGG + Intergenic
934794810 2:97091461-97091483 CCACCCTCTCAGTGGCAAGAAGG - Exonic
938089927 2:128424797-128424819 CCATCCTCTCTGCCTCAAGGGGG - Intergenic
939636102 2:144584220-144584242 GCACCCTTTCTGTCTCAGGAGGG + Intergenic
943377234 2:187092499-187092521 ACACACTTTCATTCTCAAAGTGG - Intergenic
944750044 2:202699549-202699571 CCATCCTTTCAGTTACATGGTGG + Intronic
946382990 2:219361592-219361614 CCACCCTCTCCCTATCAAGGTGG - Intergenic
948721775 2:239905277-239905299 CAACCCTTTGAGTCTCACAGAGG + Intronic
1168907492 20:1417876-1417898 CCAATCTTGCAGTCTCAAGAGGG - Intergenic
1169009266 20:2236753-2236775 CAATCCTCTCAGTGTCAAGGTGG + Intergenic
1169565961 20:6853891-6853913 CCCACCTTTCATTCTCAAGTAGG + Intergenic
1170696762 20:18666129-18666151 CCACCTTGACAGTCTTAAGGAGG + Intronic
1170877388 20:20263051-20263073 CAACCATTTCACTCTCAACGAGG + Exonic
1174515838 20:51091870-51091892 CCTCCCTCTCAGTGTGAAGGGGG + Intergenic
1175114638 20:56673513-56673535 CCATCCTTTCAGTCTCTACTGGG + Intergenic
1180912974 22:19466065-19466087 TCACCCTTTCACCCTCAAGTTGG - Intronic
1181634592 22:24168752-24168774 CCACCTTTTCTGTAACAAGGAGG + Intronic
1183157241 22:36084935-36084957 CCTGCCTTTCATTCTCGAGGTGG + Intergenic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
961654986 3:128436195-128436217 CCACCCTTCCAGTCTTCAGCTGG - Intergenic
966077031 3:175948964-175948986 CCACCCCTTCATCCTCAAGTAGG - Intergenic
967434127 3:189424972-189424994 CCAGCCCTCCAGTCCCAAGGAGG - Intergenic
968381567 4:101088-101110 CCACCCTTCCAGTGTGCAGGTGG - Intergenic
973841000 4:54860493-54860515 CCACCCAGTCAGTCTCTGGGTGG + Intergenic
974148247 4:57972603-57972625 CCAACCTTTCACCCTCAAGCTGG - Intergenic
974242686 4:59271418-59271440 CCACCATTTCAGTCTAAAGTAGG + Intergenic
979631052 4:122903667-122903689 CCAGCCTTGCAGTCTAATGGTGG - Intronic
982762643 4:159304913-159304935 CCACGTTTTCAGTCACAAGTGGG - Intronic
982918602 4:161246100-161246122 TCACCCTTTCAGTTTAAAGTAGG - Intergenic
985614347 5:910588-910610 TCTCCCTGTCAGTCACAAGGGGG + Intronic
985722489 5:1497073-1497095 CCACCCTTTCTGTCTCCTTGGGG - Intronic
986196128 5:5537610-5537632 CCTTCCTTTCATTCTCAAGAGGG - Intergenic
989105053 5:37855176-37855198 CCTCCGTTTCACCCTCAAGGAGG + Intergenic
989154229 5:38329035-38329057 CCACACTTTTAGGGTCAAGGCGG + Intronic
989546022 5:42674380-42674402 CCACCTTTTTAATCTCAAAGTGG + Intronic
993297924 5:86167487-86167509 ACATCCTTTTAGTTTCAAGGTGG + Intergenic
993603365 5:89956216-89956238 TGACCATTTCAGTCACAAGGAGG + Intergenic
994059353 5:95456749-95456771 CCATCCTTCCTCTCTCAAGGAGG - Intergenic
999474392 5:151885144-151885166 CCAACCTTTCAGTCCCAGGCTGG - Intronic
1000100419 5:158011072-158011094 CCACACTTTGAGTAGCAAGGAGG + Intergenic
1001569711 5:172722327-172722349 TCACCTCTTCTGTCTCAAGGTGG + Intergenic
1003943478 6:11051528-11051550 CAACCATTTAGGTCTCAAGGAGG + Intergenic
1004489765 6:16103615-16103637 CCACCCATTCAGTCCCACAGTGG - Intergenic
1005822625 6:29610163-29610185 CCTCCCCTTCATTCTCAAGGAGG + Intronic
1006918638 6:37613311-37613333 CCACCCTGTGACTCTCATGGTGG - Intergenic
1007510549 6:42371374-42371396 CTACCCTTCCAGTGTCTAGGAGG + Intronic
1008054067 6:46928428-46928450 CCACCCTTCCAGTCACAACTTGG - Intronic
1012517058 6:100073972-100073994 CCAGCCATTCAGTCTCAGGGTGG - Intergenic
1018275438 6:162125317-162125339 CCCCCCTTACATTCTCAAGGAGG + Intronic
1019568365 7:1696054-1696076 CCAGACTTCCAGTCTCAGGGCGG - Intronic
1021901309 7:25288463-25288485 CCTCCCTATCAGTATCATGGTGG + Intergenic
1022122413 7:27322071-27322093 GCACCCTTTCCTTCTGAAGGAGG - Intergenic
1026023773 7:66729677-66729699 TCACCCATCCAGTCTCCAGGTGG + Intronic
1027262847 7:76477341-76477363 CCACCCTTTCAGTCTCAAGGAGG - Intronic
1027314229 7:76975450-76975472 CCACCCTTTCAGTCTCAAGGAGG - Intergenic
1029374167 7:100167953-100167975 CCACCCTTTCAGTCTCCTCCGGG - Intronic
1032369947 7:131338873-131338895 TCGACCTTTCTGTCTCAAGGTGG - Intronic
1035168924 7:157007258-157007280 CCTCCTTTTCTGTCTTAAGGAGG - Intronic
1038964878 8:32561175-32561197 CTATACTTTCAGTCTCAAGATGG + Intronic
1043096557 8:75982508-75982530 CGACTCTTTCATTGTCAAGGAGG + Intergenic
1050237428 9:3596679-3596701 CTAGCCTTTTTGTCTCAAGGAGG + Intergenic
1056929551 9:90862542-90862564 CCCCACTTTCAGCCTCCAGGTGG + Intronic
1058943228 9:109833582-109833604 ACATCCTTTGAGGCTCAAGGGGG - Intronic
1060470216 9:123942434-123942456 CTCCCCTCTCAGCCTCAAGGAGG - Intergenic
1186425882 X:9464611-9464633 CCACCCCCTCAGTTTCTAGGGGG - Intronic
1189982871 X:46528507-46528529 CCACCCCTGCAGGCTGAAGGTGG + Intronic
1191568088 X:62566922-62566944 GGACCCTTTCAGTCCTAAGGTGG + Intergenic
1199908152 X:152256913-152256935 ACACCCTTACTGGCTCAAGGTGG + Intronic