ID: 1027316770

View in Genome Browser
Species Human (GRCh38)
Location 7:76990525-76990547
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027316770_1027316775 -6 Left 1027316770 7:76990525-76990547 CCCAGAGTGAGCCCAGGTGCCCC No data
Right 1027316775 7:76990542-76990564 TGCCCCTCCTTTTGCTCTCTGGG No data
1027316770_1027316787 25 Left 1027316770 7:76990525-76990547 CCCAGAGTGAGCCCAGGTGCCCC No data
Right 1027316787 7:76990573-76990595 CCTGATGACGGTGGGCGCTCGGG No data
1027316770_1027316774 -7 Left 1027316770 7:76990525-76990547 CCCAGAGTGAGCCCAGGTGCCCC No data
Right 1027316774 7:76990541-76990563 GTGCCCCTCCTTTTGCTCTCTGG No data
1027316770_1027316785 24 Left 1027316770 7:76990525-76990547 CCCAGAGTGAGCCCAGGTGCCCC No data
Right 1027316785 7:76990572-76990594 GCCTGATGACGGTGGGCGCTCGG No data
1027316770_1027316780 1 Left 1027316770 7:76990525-76990547 CCCAGAGTGAGCCCAGGTGCCCC No data
Right 1027316780 7:76990549-76990571 CCTTTTGCTCTCTGGGTACGTGG No data
1027316770_1027316781 2 Left 1027316770 7:76990525-76990547 CCCAGAGTGAGCCCAGGTGCCCC No data
Right 1027316781 7:76990550-76990572 CTTTTGCTCTCTGGGTACGTGGG No data
1027316770_1027316783 16 Left 1027316770 7:76990525-76990547 CCCAGAGTGAGCCCAGGTGCCCC No data
Right 1027316783 7:76990564-76990586 GTACGTGGGCCTGATGACGGTGG No data
1027316770_1027316782 13 Left 1027316770 7:76990525-76990547 CCCAGAGTGAGCCCAGGTGCCCC No data
Right 1027316782 7:76990561-76990583 TGGGTACGTGGGCCTGATGACGG No data
1027316770_1027316784 17 Left 1027316770 7:76990525-76990547 CCCAGAGTGAGCCCAGGTGCCCC No data
Right 1027316784 7:76990565-76990587 TACGTGGGCCTGATGACGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027316770 Original CRISPR GGGGCACCTGGGCTCACTCT GGG (reversed) Intergenic
No off target data available for this crispr