ID: 1027316771

View in Genome Browser
Species Human (GRCh38)
Location 7:76990526-76990548
Sequence AGGGGCACCTGGGCTCACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027316771_1027316783 15 Left 1027316771 7:76990526-76990548 CCAGAGTGAGCCCAGGTGCCCCT No data
Right 1027316783 7:76990564-76990586 GTACGTGGGCCTGATGACGGTGG No data
1027316771_1027316774 -8 Left 1027316771 7:76990526-76990548 CCAGAGTGAGCCCAGGTGCCCCT No data
Right 1027316774 7:76990541-76990563 GTGCCCCTCCTTTTGCTCTCTGG No data
1027316771_1027316780 0 Left 1027316771 7:76990526-76990548 CCAGAGTGAGCCCAGGTGCCCCT No data
Right 1027316780 7:76990549-76990571 CCTTTTGCTCTCTGGGTACGTGG No data
1027316771_1027316785 23 Left 1027316771 7:76990526-76990548 CCAGAGTGAGCCCAGGTGCCCCT No data
Right 1027316785 7:76990572-76990594 GCCTGATGACGGTGGGCGCTCGG No data
1027316771_1027316787 24 Left 1027316771 7:76990526-76990548 CCAGAGTGAGCCCAGGTGCCCCT No data
Right 1027316787 7:76990573-76990595 CCTGATGACGGTGGGCGCTCGGG No data
1027316771_1027316781 1 Left 1027316771 7:76990526-76990548 CCAGAGTGAGCCCAGGTGCCCCT No data
Right 1027316781 7:76990550-76990572 CTTTTGCTCTCTGGGTACGTGGG No data
1027316771_1027316782 12 Left 1027316771 7:76990526-76990548 CCAGAGTGAGCCCAGGTGCCCCT No data
Right 1027316782 7:76990561-76990583 TGGGTACGTGGGCCTGATGACGG No data
1027316771_1027316784 16 Left 1027316771 7:76990526-76990548 CCAGAGTGAGCCCAGGTGCCCCT No data
Right 1027316784 7:76990565-76990587 TACGTGGGCCTGATGACGGTGGG No data
1027316771_1027316775 -7 Left 1027316771 7:76990526-76990548 CCAGAGTGAGCCCAGGTGCCCCT No data
Right 1027316775 7:76990542-76990564 TGCCCCTCCTTTTGCTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027316771 Original CRISPR AGGGGCACCTGGGCTCACTC TGG (reversed) Intergenic
No off target data available for this crispr