ID: 1027316776

View in Genome Browser
Species Human (GRCh38)
Location 7:76990544-76990566
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027316776_1027316785 5 Left 1027316776 7:76990544-76990566 CCCCTCCTTTTGCTCTCTGGGTA No data
Right 1027316785 7:76990572-76990594 GCCTGATGACGGTGGGCGCTCGG No data
1027316776_1027316787 6 Left 1027316776 7:76990544-76990566 CCCCTCCTTTTGCTCTCTGGGTA No data
Right 1027316787 7:76990573-76990595 CCTGATGACGGTGGGCGCTCGGG No data
1027316776_1027316784 -2 Left 1027316776 7:76990544-76990566 CCCCTCCTTTTGCTCTCTGGGTA No data
Right 1027316784 7:76990565-76990587 TACGTGGGCCTGATGACGGTGGG No data
1027316776_1027316782 -6 Left 1027316776 7:76990544-76990566 CCCCTCCTTTTGCTCTCTGGGTA No data
Right 1027316782 7:76990561-76990583 TGGGTACGTGGGCCTGATGACGG No data
1027316776_1027316783 -3 Left 1027316776 7:76990544-76990566 CCCCTCCTTTTGCTCTCTGGGTA No data
Right 1027316783 7:76990564-76990586 GTACGTGGGCCTGATGACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027316776 Original CRISPR TACCCAGAGAGCAAAAGGAG GGG (reversed) Intergenic
No off target data available for this crispr