ID: 1027316780

View in Genome Browser
Species Human (GRCh38)
Location 7:76990549-76990571
Sequence CCTTTTGCTCTCTGGGTACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027316772_1027316780 -10 Left 1027316772 7:76990536-76990558 CCCAGGTGCCCCTCCTTTTGCTC No data
Right 1027316780 7:76990549-76990571 CCTTTTGCTCTCTGGGTACGTGG No data
1027316767_1027316780 24 Left 1027316767 7:76990502-76990524 CCTCTTTCTGGTGATGGTGTCAC No data
Right 1027316780 7:76990549-76990571 CCTTTTGCTCTCTGGGTACGTGG No data
1027316770_1027316780 1 Left 1027316770 7:76990525-76990547 CCCAGAGTGAGCCCAGGTGCCCC No data
Right 1027316780 7:76990549-76990571 CCTTTTGCTCTCTGGGTACGTGG No data
1027316771_1027316780 0 Left 1027316771 7:76990526-76990548 CCAGAGTGAGCCCAGGTGCCCCT No data
Right 1027316780 7:76990549-76990571 CCTTTTGCTCTCTGGGTACGTGG No data
1027316769_1027316780 2 Left 1027316769 7:76990524-76990546 CCCCAGAGTGAGCCCAGGTGCCC No data
Right 1027316780 7:76990549-76990571 CCTTTTGCTCTCTGGGTACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027316780 Original CRISPR CCTTTTGCTCTCTGGGTACG TGG Intergenic
No off target data available for this crispr