ID: 1027316782

View in Genome Browser
Species Human (GRCh38)
Location 7:76990561-76990583
Sequence TGGGTACGTGGGCCTGATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027316770_1027316782 13 Left 1027316770 7:76990525-76990547 CCCAGAGTGAGCCCAGGTGCCCC No data
Right 1027316782 7:76990561-76990583 TGGGTACGTGGGCCTGATGACGG No data
1027316778_1027316782 -8 Left 1027316778 7:76990546-76990568 CCTCCTTTTGCTCTCTGGGTACG No data
Right 1027316782 7:76990561-76990583 TGGGTACGTGGGCCTGATGACGG No data
1027316776_1027316782 -6 Left 1027316776 7:76990544-76990566 CCCCTCCTTTTGCTCTCTGGGTA No data
Right 1027316782 7:76990561-76990583 TGGGTACGTGGGCCTGATGACGG No data
1027316771_1027316782 12 Left 1027316771 7:76990526-76990548 CCAGAGTGAGCCCAGGTGCCCCT No data
Right 1027316782 7:76990561-76990583 TGGGTACGTGGGCCTGATGACGG No data
1027316773_1027316782 1 Left 1027316773 7:76990537-76990559 CCAGGTGCCCCTCCTTTTGCTCT No data
Right 1027316782 7:76990561-76990583 TGGGTACGTGGGCCTGATGACGG No data
1027316769_1027316782 14 Left 1027316769 7:76990524-76990546 CCCCAGAGTGAGCCCAGGTGCCC No data
Right 1027316782 7:76990561-76990583 TGGGTACGTGGGCCTGATGACGG No data
1027316777_1027316782 -7 Left 1027316777 7:76990545-76990567 CCCTCCTTTTGCTCTCTGGGTAC No data
Right 1027316782 7:76990561-76990583 TGGGTACGTGGGCCTGATGACGG No data
1027316772_1027316782 2 Left 1027316772 7:76990536-76990558 CCCAGGTGCCCCTCCTTTTGCTC No data
Right 1027316782 7:76990561-76990583 TGGGTACGTGGGCCTGATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027316782 Original CRISPR TGGGTACGTGGGCCTGATGA CGG Intergenic
No off target data available for this crispr