ID: 1027316785

View in Genome Browser
Species Human (GRCh38)
Location 7:76990572-76990594
Sequence GCCTGATGACGGTGGGCGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027316772_1027316785 13 Left 1027316772 7:76990536-76990558 CCCAGGTGCCCCTCCTTTTGCTC No data
Right 1027316785 7:76990572-76990594 GCCTGATGACGGTGGGCGCTCGG No data
1027316779_1027316785 0 Left 1027316779 7:76990549-76990571 CCTTTTGCTCTCTGGGTACGTGG No data
Right 1027316785 7:76990572-76990594 GCCTGATGACGGTGGGCGCTCGG No data
1027316777_1027316785 4 Left 1027316777 7:76990545-76990567 CCCTCCTTTTGCTCTCTGGGTAC No data
Right 1027316785 7:76990572-76990594 GCCTGATGACGGTGGGCGCTCGG No data
1027316770_1027316785 24 Left 1027316770 7:76990525-76990547 CCCAGAGTGAGCCCAGGTGCCCC No data
Right 1027316785 7:76990572-76990594 GCCTGATGACGGTGGGCGCTCGG No data
1027316773_1027316785 12 Left 1027316773 7:76990537-76990559 CCAGGTGCCCCTCCTTTTGCTCT No data
Right 1027316785 7:76990572-76990594 GCCTGATGACGGTGGGCGCTCGG No data
1027316776_1027316785 5 Left 1027316776 7:76990544-76990566 CCCCTCCTTTTGCTCTCTGGGTA No data
Right 1027316785 7:76990572-76990594 GCCTGATGACGGTGGGCGCTCGG No data
1027316769_1027316785 25 Left 1027316769 7:76990524-76990546 CCCCAGAGTGAGCCCAGGTGCCC No data
Right 1027316785 7:76990572-76990594 GCCTGATGACGGTGGGCGCTCGG No data
1027316771_1027316785 23 Left 1027316771 7:76990526-76990548 CCAGAGTGAGCCCAGGTGCCCCT No data
Right 1027316785 7:76990572-76990594 GCCTGATGACGGTGGGCGCTCGG No data
1027316778_1027316785 3 Left 1027316778 7:76990546-76990568 CCTCCTTTTGCTCTCTGGGTACG No data
Right 1027316785 7:76990572-76990594 GCCTGATGACGGTGGGCGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027316785 Original CRISPR GCCTGATGACGGTGGGCGCT CGG Intergenic
No off target data available for this crispr