ID: 1027317070

View in Genome Browser
Species Human (GRCh38)
Location 7:76992280-76992302
Sequence GGGTGCCCCTGACCCCTCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027317064_1027317070 5 Left 1027317064 7:76992252-76992274 CCTCAGAAGAGCAGTCTTGGGTG 0: 2
1: 1
2: 4
3: 16
4: 144
Right 1027317070 7:76992280-76992302 GGGTGCCCCTGACCCCTCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027317070 Original CRISPR GGGTGCCCCTGACCCCTCGT GGG Intergenic
No off target data available for this crispr