ID: 1027327256

View in Genome Browser
Species Human (GRCh38)
Location 7:77058302-77058324
Sequence TTGTGCTTCTAGAAGAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85959
Summary {0: 8, 1: 0, 2: 152, 3: 5593, 4: 80206}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027327246_1027327256 28 Left 1027327246 7:77058251-77058273 CCTCCCAAGTAGCTGGGATTACA 0: 48952
1: 142577
2: 242332
3: 522592
4: 386712
Right 1027327256 7:77058302-77058324 TTGTGCTTCTAGAAGAGACAGGG 0: 8
1: 0
2: 152
3: 5593
4: 80206
1027327250_1027327256 1 Left 1027327250 7:77058278-77058300 CCCACCAGAACACCCAGCTCATT No data
Right 1027327256 7:77058302-77058324 TTGTGCTTCTAGAAGAGACAGGG 0: 8
1: 0
2: 152
3: 5593
4: 80206
1027327248_1027327256 25 Left 1027327248 7:77058254-77058276 CCCAAGTAGCTGGGATTACAGGT 0: 15366
1: 98640
2: 233329
3: 337639
4: 469862
Right 1027327256 7:77058302-77058324 TTGTGCTTCTAGAAGAGACAGGG 0: 8
1: 0
2: 152
3: 5593
4: 80206
1027327252_1027327256 -3 Left 1027327252 7:77058282-77058304 CCAGAACACCCAGCTCATTTTTG No data
Right 1027327256 7:77058302-77058324 TTGTGCTTCTAGAAGAGACAGGG 0: 8
1: 0
2: 152
3: 5593
4: 80206
1027327249_1027327256 24 Left 1027327249 7:77058255-77058277 CCAAGTAGCTGGGATTACAGGTG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720
Right 1027327256 7:77058302-77058324 TTGTGCTTCTAGAAGAGACAGGG 0: 8
1: 0
2: 152
3: 5593
4: 80206
1027327251_1027327256 0 Left 1027327251 7:77058279-77058301 CCACCAGAACACCCAGCTCATTT No data
Right 1027327256 7:77058302-77058324 TTGTGCTTCTAGAAGAGACAGGG 0: 8
1: 0
2: 152
3: 5593
4: 80206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027327256 Original CRISPR TTGTGCTTCTAGAAGAGACA GGG Intergenic
Too many off-targets to display for this crispr