ID: 1027329681

View in Genome Browser
Species Human (GRCh38)
Location 7:77078538-77078560
Sequence TAGCTTGTCTAAAGGACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027329681_1027329685 0 Left 1027329681 7:77078538-77078560 CCCTCTGTCCTTTAGACAAGCTA No data
Right 1027329685 7:77078561-77078583 AGAACTCTTTTCTGACTTGGTGG 0: 2
1: 0
2: 0
3: 22
4: 166
1027329681_1027329684 -3 Left 1027329681 7:77078538-77078560 CCCTCTGTCCTTTAGACAAGCTA No data
Right 1027329684 7:77078558-77078580 CTAAGAACTCTTTTCTGACTTGG 0: 2
1: 0
2: 1
3: 16
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027329681 Original CRISPR TAGCTTGTCTAAAGGACAGA GGG (reversed) Intergenic
No off target data available for this crispr