ID: 1027334768

View in Genome Browser
Species Human (GRCh38)
Location 7:77137986-77138008
Sequence GCTGGTGATACTGACCATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 2, 1: 2, 2: 2, 3: 19, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027334768 Original CRISPR GCTGGTGATACTGACCATGC TGG Intronic
900076278 1:820434-820456 GGTGGATATACTGACCAGGCAGG - Intergenic
900186101 1:1333954-1333976 GGTGGTGCTGCTGGCCATGCTGG + Exonic
901194060 1:7430364-7430386 GATGGTGATGGTGACCATGGTGG + Intronic
903087675 1:20877452-20877474 GCTAGTAACACTGACCATTCAGG + Intronic
903197828 1:21706008-21706030 GCTGGTGAAAGTAACCATGAAGG + Intronic
904349262 1:29894310-29894332 GCTGGTGCTACTGAGCATCAGGG + Intergenic
905891091 1:41518862-41518884 GCTGGTGACACTCATCAGGCAGG + Intronic
906359773 1:45144330-45144352 TCTCGTGATACTGACCTTGCTGG - Intronic
906530441 1:46520725-46520747 GCTGGTGCCACTGAGCATTCAGG - Intergenic
909071584 1:71000398-71000420 ACTGGTGATAATGACCATAGTGG - Intronic
913942306 1:125119797-125119819 GCAGGAGATACAGACCGTGCAGG + Intergenic
913964964 1:143369260-143369282 TCTGGTGATACTGCCATTGCTGG + Intergenic
914059338 1:144194862-144194884 TCTGGTGATACTGCCATTGCTGG + Intergenic
914119812 1:144771509-144771531 TCTGGTGATACTGCCATTGCTGG - Intergenic
917308882 1:173656579-173656601 GCTGTTGAAACTGGCCATGTCGG - Intronic
920432369 1:205927243-205927265 GGTGGTGATGATCACCATGCTGG - Exonic
922395276 1:225193492-225193514 TCTTGTGATATTGACCAGGCTGG - Intronic
923014951 1:230119662-230119684 CCTGGTGGTACTGTCCATGGGGG + Intronic
1063528932 10:6811449-6811471 CCTTGTGATAATGACCATGGTGG - Intergenic
1069229987 10:65996772-65996794 CCAGGTGATCCTGACCAAGCTGG + Intronic
1071136599 10:82461145-82461167 GGTGGTGATACTGATCATAATGG - Intronic
1072216438 10:93291222-93291244 GCTGGGGACACACACCATGCAGG - Intergenic
1074363188 10:112838887-112838909 GATGGTGATACTGACTTTGCAGG + Intergenic
1075088055 10:119426740-119426762 GATGGTGATACTGATGATGGCGG - Intronic
1075088122 10:119427524-119427546 GGTGGTGATACTGATGATGGCGG - Intronic
1075997346 10:126888901-126888923 GCTGGTGACTCTGACCATTTAGG - Intergenic
1076305234 10:129461469-129461491 GCTGGTGCTCCTCACGATGCAGG - Intergenic
1077608249 11:3626732-3626754 GCGGGTGAAGCTGAGCATGCTGG - Intergenic
1080757386 11:35215143-35215165 CCTGGTAATACTGACACTGCTGG + Intronic
1082301726 11:50514017-50514039 GATGGTCATAATGCCCATGCTGG + Intergenic
1084290417 11:68161982-68162004 GGTGGTGATATTGACCAAGATGG - Intronic
1090419814 11:126566945-126566967 GCTGGTGATAGTGCCCATGCTGG + Intronic
1090503941 11:127289237-127289259 GCTGGTTATACTGGCAGTGCAGG - Intergenic
1091447304 12:551355-551377 GCTGGCGGGACTGACCAGGCAGG - Intronic
1091860424 12:3776572-3776594 GATGGTGACACTTACTATGCTGG + Intergenic
1093081864 12:14821838-14821860 GATGGTGGTAGTGACCTTGCAGG - Intronic
1094713366 12:32986950-32986972 GCTGGTGAGCGTGAACATGCAGG + Intergenic
1095698208 12:45164575-45164597 TCTGGTGATGCTGACAATGCTGG - Intergenic
1095698541 12:45166965-45166987 TCTGGTGATGCTGACAATGCTGG - Intergenic
1096008599 12:48193275-48193297 GCTGGTAATGCTGAGCAAGCAGG - Intergenic
1099070275 12:78037328-78037350 GGAGGTGATCCTTACCATGCTGG + Intronic
1102036623 12:109774072-109774094 TCTCGTGATACTGCCCAAGCTGG - Intergenic
1109388544 13:61665218-61665240 GCTGCTGACCCTGACCTTGCAGG - Intergenic
1109764424 13:66875106-66875128 GATGTTGATACTGACCCTGTAGG - Intronic
1112275940 13:98019383-98019405 GCTAGTGCTCCTGTCCATGCTGG + Intronic
1115801971 14:37004745-37004767 GCAGGTGCTTCTGACCAAGCTGG - Intronic
1117644256 14:57834822-57834844 GCTGGCCATGCTGGCCATGCTGG - Intronic
1120145544 14:80974787-80974809 GCTGTTGATACTGAACATATTGG - Intronic
1120755541 14:88240795-88240817 GCTCTTGATGCTGACAATGCGGG - Exonic
1121739416 14:96240904-96240926 GCTGGTGTTCCGGACCATGAAGG + Exonic
1126682984 15:51221857-51221879 GCTGGTGATACTGATGCTGATGG - Intronic
1128378225 15:67092435-67092457 CCTGGTGATGCTGACGCTGCTGG - Intronic
1128906689 15:71473844-71473866 CCAGGTGATACTGACTATGCTGG - Intronic
1129231047 15:74197393-74197415 GCTGCTGCTCCTGGCCATGCTGG - Exonic
1130367020 15:83249941-83249963 CCAGGTGATACTGACGATACTGG + Intergenic
1130556355 15:84925273-84925295 GCAGGTGATGCTGACAATGCTGG - Intronic
1135493623 16:22932254-22932276 CCAGGTGATACTGATGATGCTGG - Intergenic
1135983686 16:27168239-27168261 GGTGGTGATGCTGACAGTGCAGG + Intergenic
1136696237 16:32084286-32084308 GCAGGAGATACGGACCGTGCAGG - Intergenic
1136796730 16:33027538-33027560 GCAGGAGATACGGACCGTGCAGG - Intergenic
1137084194 16:36101163-36101185 GCAGGAGATACGGACCGTGCAGG - Intergenic
1139516390 16:67454840-67454862 GCTGGGGATAGTGAGCATGGGGG - Intronic
1139599362 16:67977312-67977334 GATGGTGACACTGTCCATGGGGG - Exonic
1139641326 16:68293851-68293873 CAAGGTGATGCTGACCATGCTGG + Intronic
1139974689 16:70800401-70800423 GCAGGTGATGCTGACCAGCCTGG - Intronic
1140704262 16:77611721-77611743 CCTGGTGATACTGATGCTGCTGG - Intergenic
1143202380 17:5121874-5121896 GGAGGTGAAACTGACAATGCAGG + Intronic
1144342507 17:14321579-14321601 GCTGGTGATACAAACCCAGCTGG - Intronic
1144626992 17:16849056-16849078 GGAGGTGAAACTGACGATGCAGG - Intergenic
1144879448 17:18423656-18423678 GGAGGTGAAACTGACGATGCAGG + Intergenic
1145152793 17:20520731-20520753 GGAGGTGAAACTGACGATGCAGG - Intergenic
1145261104 17:21355304-21355326 TGTGGTGAGACTGACCTTGCCGG + Intergenic
1145690239 17:26731938-26731960 GCAGGAGATACGGACCATGGAGG + Intergenic
1146164131 17:30574902-30574924 GGAGGTGAAACTGACCATGCAGG - Intergenic
1146212426 17:30952911-30952933 GCTGGTGATACCCACCTCGCAGG + Intronic
1146331947 17:31934835-31934857 TCTGGAGATCCTGACCATCCAGG + Intergenic
1147581127 17:41627741-41627763 GGAGGTGATACTGACGATGCAGG - Intergenic
1151976119 17:77484346-77484368 GATGGTGATAGTGATCATGAGGG + Intronic
1152560738 17:81077678-81077700 GCTGGTGGTGCTGAGTATGCGGG + Intronic
1156648112 18:39191572-39191594 TCTGCAGAAACTGACCATGCTGG - Intergenic
1157672347 18:49541051-49541073 GCAGGTGATACTGATGCTGCTGG + Intergenic
1159882352 18:73870492-73870514 TCTGGTGTTACTGGCCATGAAGG - Intergenic
1160135550 18:76268129-76268151 GCTGAAAATACTAACCATGCTGG - Intergenic
1161899471 19:7107594-7107616 GGTGATGATACTGACGATGATGG + Intergenic
1168297376 19:55384007-55384029 GCTGGTGTTCCTGAGCCTGCTGG - Exonic
1202669887 1_KI270709v1_random:40600-40622 GCAGGAGATACAGACCGTGCAGG + Intergenic
1202698741 1_KI270712v1_random:146749-146771 TCTGGTGATACTGCCATTGCTGG + Intergenic
927279926 2:21295865-21295887 GCTGGAGATGCTGAACATGTTGG - Intergenic
929440797 2:41964597-41964619 GCTGGTAAAACTGACAATGGAGG + Intergenic
929642854 2:43598958-43598980 GCTGGTGGCACTGACCAGGGTGG + Intergenic
930724431 2:54668466-54668488 GCTGGTGATGGTGACGACGCTGG - Exonic
931056384 2:58476662-58476684 GCTGGTGATACTGCTGTTGCTGG - Intergenic
931261910 2:60627580-60627602 TCTGCTGATTCTGACCATGCTGG + Intergenic
931634382 2:64328440-64328462 GCTTGTGATACCGACTGTGCTGG - Intergenic
931767598 2:65470790-65470812 GCTGGTTATAATGATCATCCTGG - Intergenic
932421757 2:71605501-71605523 GCTTGTGATCCTGACCATTTCGG + Intronic
932636216 2:73390615-73390637 GCTGGTCCTACAGACCATTCAGG + Intronic
934279991 2:91604534-91604556 TCTGGTGATACTGCCATTGCTGG + Intergenic
935103333 2:100017032-100017054 GGTGGTGATGATGACGATGCTGG + Intronic
935224154 2:101038587-101038609 GCTTCTGATACTGACAATGATGG + Exonic
935573511 2:104687015-104687037 GCGGGTGGCACTGACCATACTGG - Intergenic
935588628 2:104824542-104824564 GGTGGTGACACTGACAATGATGG + Intergenic
935722571 2:105992442-105992464 GCTGGTGGTACTCACCATGGTGG + Intergenic
937313511 2:120916544-120916566 GCTGGAGAGCCTGACCCTGCGGG - Intronic
938239895 2:129735434-129735456 GGTGGTGATAATGATGATGCTGG + Intergenic
938984411 2:136560072-136560094 ACTGGTGATACTGCCCATGATGG - Intergenic
941890568 2:170576838-170576860 GCTGGTGATTCAGACCCTTCAGG - Intronic
947578289 2:231294230-231294252 GCTGGTGACATTGACAACGCCGG + Intronic
947990068 2:234479781-234479803 CCTGGTGATGCTGACCCTGCTGG - Intergenic
948032909 2:234834196-234834218 AATGGTGATACTGACCATGCAGG - Intergenic
1169807151 20:9571301-9571323 GCTGGTGATACGCACCATCATGG - Intronic
1170497717 20:16942721-16942743 TCTGGTGCTACTGTCAATGCTGG - Intergenic
1171892506 20:30728846-30728868 GCTGGAGCTTCTGGCCATGCTGG + Intergenic
1172179613 20:32993832-32993854 CCAGGTGATACTGATGATGCAGG + Intronic
1173024667 20:39296738-39296760 GCTGGTGTCACTGGACATGCTGG + Intergenic
1173080840 20:39865615-39865637 GATGGTGATGGTGACGATGCTGG - Intergenic
1175442423 20:59001288-59001310 GCTGGTGCTCTTGACCATGAGGG - Intronic
1176064674 20:63188351-63188373 GTTTGTGAGACTGACCATCCCGG - Intergenic
1178144209 21:29719616-29719638 GCAGGGGATGATGACCATGCTGG - Intronic
1179015678 21:37592789-37592811 CCTGCTGACACTGACCAGGCTGG + Intergenic
1181034189 22:20162081-20162103 GCTGGTGGAGCTGACCATGATGG - Intergenic
1184373769 22:44098997-44099019 GCTGGGGACACTGACCATGTCGG - Intronic
1184833959 22:47009658-47009680 GCTGGTGATAGTGATGATGATGG - Intronic
949096622 3:94116-94138 GCAGGTGATACTGATTTTGCTGG - Intergenic
953827540 3:46267075-46267097 TCTGGTGATGCTGATGATGCTGG + Intergenic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
955950853 3:64240694-64240716 CCTGGTGATACTGAGGCTGCTGG - Intronic
956466955 3:69528843-69528865 CATGGTGATACTCACCATGGTGG + Intronic
961650539 3:128414719-128414741 GCTGGTGATGCTGATGATGATGG - Intergenic
961727976 3:128945365-128945387 GCTGCTGATCCTGACCTTGGGGG - Exonic
962437406 3:135379818-135379840 GCTAATGATAATGACCTTGCAGG + Intergenic
962491049 3:135894399-135894421 CCTGATCATACTGACCATGTAGG - Intergenic
966402851 3:179564059-179564081 GCAGGTGATGCTGACACTGCTGG - Intronic
967438111 3:189474921-189474943 GCTGGTAATACTCACCATCGTGG + Intergenic
969683381 4:8655738-8655760 GCTGGTGATACAGCAAATGCAGG + Intergenic
972039784 4:34578668-34578690 GCTTTTTATTCTGACCATGCTGG - Intergenic
972401281 4:38706042-38706064 GATGGACAGACTGACCATGCAGG - Intergenic
977824342 4:101512498-101512520 GCTGGTGATGGTGAGCAAGCAGG - Intronic
978713079 4:111809190-111809212 GATGTTGCTTCTGACCATGCAGG - Intergenic
980119584 4:128714040-128714062 TCAGGAGATACAGACCATGCTGG - Intergenic
981790077 4:148526588-148526610 GCTGGTGAGCATGAACATGCAGG - Intergenic
983146916 4:164228116-164228138 GATGATGATACTGACGATGTTGG + Intronic
983341914 4:166471707-166471729 GCAGGTGAGAATCACCATGCTGG - Intergenic
984590531 4:181612564-181612586 GTTGGTGATAAAGACCATACTGG - Intergenic
987148187 5:15012913-15012935 TCTGGTGAAACTGACCATATAGG + Intergenic
987475761 5:18391026-18391048 GATGGTGATATTGATCATCCTGG - Intergenic
987616100 5:20276518-20276540 GCTGTTGATTCTGACTATTCAGG - Intronic
988440065 5:31223913-31223935 GATGGTGATAATGACAATGGTGG + Intronic
988484775 5:31659504-31659526 GGGGGTGACACTGACCAAGCTGG - Intronic
990930391 5:61083556-61083578 GTTGGCCATCCTGACCATGCTGG + Intronic
992810425 5:80382327-80382349 CCTGGCGACACTGAACATGCTGG - Intergenic
993738095 5:91501860-91501882 CCTGGTGATACTGACACTGCTGG - Intergenic
997250518 5:132385452-132385474 GCTGGTGGCGCTGACGATGCCGG + Exonic
997597180 5:135114808-135114830 TCTGGTGATCCTGATCATGCTGG - Intronic
997829035 5:137133156-137133178 TCAGGTGATACAGACCATCCTGG + Intronic
1000004005 5:157166360-157166382 GCTGGTGACACTGACCAGAGGGG - Intronic
1000449860 5:161372290-161372312 GCAGATGATCCTGGCCATGCAGG - Intronic
1002424747 5:179168343-179168365 GCTGGTGCTCCTGACCAGCCGGG + Intronic
1003099144 6:3163707-3163729 ACTGGTAAAACTGACCATGCCGG - Intergenic
1007635209 6:43295767-43295789 GATGGTGACAGTGACCATGATGG - Intronic
1008437526 6:51494025-51494047 GCTGGTGATTCTGACCCAACTGG - Intergenic
1010637388 6:78277808-78277830 TATCGTGATAATGACCATGCAGG - Intergenic
1012627354 6:101420497-101420519 CCTGGTGGTACTGATGATGCTGG - Intronic
1014888050 6:126806247-126806269 GCTGGTGATAATGCCTATGAAGG + Intergenic
1016091479 6:139984536-139984558 GCTGCTGCGACTGAACATGCTGG + Intergenic
1017989600 6:159474556-159474578 GCTGCTCATCCTGACGATGCAGG - Intergenic
1018110778 6:160535087-160535109 GATGGTGATAGTGATCATGGTGG + Intronic
1018838877 6:167505143-167505165 CCAGGTGATGCTGACAATGCTGG + Intergenic
1022632638 7:32099935-32099957 GTTGGTGATGCTGACAATGAGGG - Intronic
1025320415 7:58088259-58088281 GCAGGAGATACGGACCGTGCAGG + Intergenic
1025561458 7:62377992-62378014 GCAGGAGATACGGACCGTGCAGG + Intergenic
1027334768 7:77137986-77138008 GCTGGTGATACTGACCATGCTGG + Intronic
1027334954 7:77140425-77140447 GCTGGTGATACTGATCATGCTGG + Intronic
1028325367 7:89517806-89517828 TCAGGTGATGCTGACCCTGCTGG - Intergenic
1029780842 7:102730688-102730710 GCTGGTGATACTGATCATGCTGG - Intergenic
1029781033 7:102733116-102733138 GCTGGTGATACTGACCATGCTGG - Intergenic
1031418470 7:121520993-121521015 CCTGGTGATGCTGATGATGCTGG - Intergenic
1033510742 7:142057666-142057688 GATGGTGATGATGACCATGGTGG + Intronic
1040419019 8:47221892-47221914 GCTGGTGATGGTGATGATGCTGG - Intergenic
1040419087 8:47222329-47222351 GCCGGTGATAGTGATGATGCCGG - Intergenic
1042513891 8:69639812-69639834 GGTGGTGATATTGATCATTCTGG - Intronic
1042821750 8:72937157-72937179 GCTGGTGAAGCTGTCGATGCTGG - Exonic
1045395461 8:101756379-101756401 GCTGGTCGTGCTGACCATTCAGG - Intronic
1047862330 8:128981717-128981739 TCTGGTGATAATGACCAGGTAGG - Intergenic
1048027817 8:130602731-130602753 ACTGTTGACACTGACCGTGCTGG - Intergenic
1049228421 8:141469283-141469305 GGTGGTGACAGTGACCATGATGG + Intergenic
1049228447 8:141469463-141469485 GGTGGTGACAGTGACCATGATGG + Intergenic
1056810225 9:89758071-89758093 GCTGGTGACACTGCCTATGGAGG + Intergenic
1056873900 9:90309403-90309425 GCTGCTGTTACTGCCCAGGCTGG + Intergenic
1056912759 9:90718300-90718322 GATGGTGTTTCTGACCATGCTGG - Intergenic
1056924892 9:90826030-90826052 CCTGGTGATGCTGACATTGCTGG + Intronic
1059254302 9:112914715-112914737 GCTGGTCATGCTGAGCCTGCTGG - Intergenic
1060269617 9:122131454-122131476 GCTGGTGCTAGAGAGCATGCCGG - Intergenic
1062018704 9:134305541-134305563 GATGGTGATGATGACCATGGTGG + Intergenic
1203747862 Un_GL000218v1:53610-53632 GCTGGAGCTTCTGGCCATGCTGG - Intergenic
1203561870 Un_KI270744v1:64366-64388 GCTGGAGCTTCTGGCCATGCTGG + Intergenic
1186837324 X:13450676-13450698 GCAGGTGATACTGATGCTGCTGG + Intergenic
1186996406 X:15128232-15128254 GCTGGTGATGCTGATGCTGCTGG - Intergenic
1189553776 X:42120521-42120543 CCAGGTGATACTGATAATGCTGG - Intergenic
1194560908 X:95418763-95418785 GCTGGTTATTCTGACCATGGGGG - Intergenic
1195125332 X:101803265-101803287 CCAGGTGATACTGACACTGCTGG - Intergenic
1198539782 X:137625398-137625420 GGTGCTGATACTGACCATGAAGG - Intergenic
1199434417 X:147797077-147797099 GCTGATGGCACTGACCATGAAGG + Intergenic
1199793663 X:151176672-151176694 GCTGCTGATCCTGAGCCTGCTGG + Exonic
1201161204 Y:11168604-11168626 GCTGGAGCTTCTGGCCATGCTGG - Intergenic
1201688710 Y:16737380-16737402 GCTGGTGATACAGACAGTGTTGG - Intergenic