ID: 1027343299

View in Genome Browser
Species Human (GRCh38)
Location 7:77232754-77232776
Sequence CAGCTGCCCATGGGGAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 6, 3: 29, 4: 319}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027343290_1027343299 28 Left 1027343290 7:77232703-77232725 CCCTGTAGAGCAGGACATTAGGG 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1027343299 7:77232754-77232776 CAGCTGCCCATGGGGAAGAAGGG 0: 1
1: 0
2: 6
3: 29
4: 319
1027343292_1027343299 27 Left 1027343292 7:77232704-77232726 CCTGTAGAGCAGGACATTAGGGA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1027343299 7:77232754-77232776 CAGCTGCCCATGGGGAAGAAGGG 0: 1
1: 0
2: 6
3: 29
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027343299 Original CRISPR CAGCTGCCCATGGGGAAGAA GGG Intronic
900650294 1:3727095-3727117 CACCTGCACATGGGGGAGCAGGG - Exonic
901190999 1:7409622-7409644 CAGCTGCCCACGGGGTAGGAGGG + Intronic
901771349 1:11531905-11531927 AGGCCGCCCATGGGGAAGAAAGG - Intronic
901838196 1:11937600-11937622 CAGCTGCCCATGATGAAGCCCGG + Intronic
902225683 1:14995093-14995115 CAGCTGCCCTGGAGGAAGAGGGG + Intronic
902244901 1:15114468-15114490 CAGCTGCCCCTGGGGAAGATAGG + Exonic
902364871 1:15966228-15966250 CAGCTTCCCATGGGGCAGGCTGG + Intronic
902624042 1:17666639-17666661 CAGCTGTTCTTGGGGGAGAAAGG - Intronic
902882281 1:19380378-19380400 CTGCTGCTCATGGGGCAGCAGGG - Intronic
903298707 1:22362862-22362884 CACCTGCCCATAGGAAAGAGGGG + Intergenic
903516721 1:23916155-23916177 AAGCCCCACATGGGGAAGAAGGG + Intergenic
904359142 1:29960965-29960987 CACCTGCACAAGGGGAACAAGGG + Intergenic
904407170 1:30299952-30299974 CAGCTGCCCAAGGGTAAGCAAGG + Intergenic
905025136 1:34844593-34844615 CCACTGTCCAAGGGGAAGAAAGG + Intronic
905261630 1:36723117-36723139 CAGCTGTCAATGGGGAGGAGTGG + Intergenic
907429561 1:54404407-54404429 CAGCTGGCCAAGGAGGAGAAGGG - Intronic
907936314 1:59045425-59045447 CATCTTCACATGGTGAAGAAGGG - Intergenic
907977785 1:59448934-59448956 CAGCAGCCCATGGTGATGAAAGG - Intronic
908178386 1:61579059-61579081 CAGCTTCCCGTGGCTAAGAAAGG + Intergenic
908984613 1:70002275-70002297 CTGATGCCCATAGAGAAGAAGGG - Intronic
909663855 1:78112400-78112422 AAGATGCCCAGAGGGAAGAATGG - Intronic
909951306 1:81723206-81723228 CAGCTGCATTTGGGGGAGAAGGG - Intronic
911645642 1:100334794-100334816 CAGCAGCCCATGAGACAGAAGGG + Intergenic
913567771 1:120090405-120090427 CAGCTGAAGATGGGGAATAAAGG - Intergenic
914288519 1:146251114-146251136 CAGCTGAAGATGGGGAATAAAGG - Intergenic
914343955 1:146782172-146782194 CAGCTGGGGACGGGGAAGAAAGG - Intergenic
914549554 1:148701858-148701880 CAGCTGAAGATGGGGAATAAAGG - Intergenic
914617126 1:149369858-149369880 CAGCTGAAGATGGGGAATAAAGG + Intergenic
915273348 1:154771271-154771293 AAGCTACTCATGGGAAAGAAGGG - Intronic
917229385 1:172819656-172819678 CCACTGCACATGGGGAGGAAAGG - Intergenic
917266603 1:173227677-173227699 CAGCTTCCCTTGGGTAGGAAAGG - Intergenic
917471502 1:175329937-175329959 CTGCTGGCCAGGGAGAAGAAGGG - Intronic
920107067 1:203561269-203561291 CAGCTGGCAATAGGGAAGCAGGG + Intergenic
920825511 1:209421181-209421203 CAGCTGGCCCTGGGGAAGCCTGG + Intergenic
920943011 1:210501636-210501658 CAGCTGCTCCTGGGGAAAAATGG + Intronic
922920266 1:229295918-229295940 CAGCTCCCCCTGGTGAAGGAGGG + Intronic
923234032 1:232015184-232015206 CACCTGCCCAAGGGAAGGAAGGG + Intronic
923496648 1:234531423-234531445 GGGCTGACCATGGGGAAGAAGGG - Intergenic
924743802 1:246814063-246814085 CGGGTTCTCATGGGGAAGAACGG - Intergenic
1063145559 10:3291987-3292009 CAGCTGCAAAAGAGGAAGAATGG + Intergenic
1063369605 10:5512521-5512543 CAGGTGCCCACGGCGAGGAAGGG - Intergenic
1065428199 10:25627649-25627671 CATGTGCCCCTGGGTAAGAACGG - Intergenic
1065918791 10:30373367-30373389 CAGGTGGCCATTTGGAAGAATGG - Intronic
1068521823 10:58085457-58085479 CAGCTGCCCAAGGTAAGGAAAGG + Intergenic
1068741161 10:60472975-60472997 GAGCTGCCTGTGGGGAAGGACGG - Intronic
1068914200 10:62410520-62410542 CAGGTGCCTATGGGGAGGGAGGG - Intronic
1069120681 10:64566228-64566250 CAGCTGATCAAGCGGAAGAAAGG - Intergenic
1069770217 10:70893761-70893783 CAGCTGCCTCTGGGGCAGAGTGG + Intergenic
1070340703 10:75495602-75495624 CAGCTGCCCGCAGGCAAGAAGGG - Intronic
1070773104 10:79094104-79094126 CAGCTGCCCTTTGGACAGAAAGG + Intronic
1071567711 10:86680296-86680318 CAGCTGACCCTGGGGAAGTGAGG + Intronic
1072696717 10:97609378-97609400 GGGCTGCCCCTGGGGAAGAGTGG + Intronic
1073387458 10:103138185-103138207 CAGCTGACCATTGGGAAGACTGG + Intronic
1074350543 10:112732743-112732765 CAGTAGCCCAAGGGGAATAAAGG - Intronic
1074892352 10:117746246-117746268 CAGCGGGGCATGGGGAGGAAGGG - Intergenic
1075762727 10:124869225-124869247 GAGCTGCCGCGGGGGAAGAAAGG - Intergenic
1077900293 11:6481967-6481989 AGGCTGGGCATGGGGAAGAAAGG + Intronic
1078103977 11:8346785-8346807 ATGCTGCCCACGTGGAAGAAGGG - Intergenic
1078285288 11:9947478-9947500 TAGATGCTGATGGGGAAGAAGGG + Intronic
1081038164 11:38176550-38176572 CTGCTGAACATTGGGAAGAAGGG + Intergenic
1081571558 11:44294497-44294519 CAGCAGCCTATGGGGAGGAGGGG + Intronic
1081688255 11:45057643-45057665 CAGCTGACACTGAGGAAGAAGGG - Intergenic
1083161972 11:60859914-60859936 CACCAGACCATGGGTAAGAAAGG - Intergenic
1084171047 11:67401303-67401325 CAGCTGCCTGTGGGCAAGGAGGG - Intronic
1085637628 11:78170644-78170666 CAGCTGCACAAGGGGAAGGGGGG - Intergenic
1087144684 11:94799989-94800011 CAGCTGTCCCTGGAGAGGAATGG + Exonic
1087484831 11:98748093-98748115 CAGCTTCCCTTGGCTAAGAAAGG - Intergenic
1087628635 11:100624634-100624656 CAGGTGATAATGGGGAAGAAGGG - Intergenic
1089519590 11:119055054-119055076 CAGCTGCCTGAGGGGAAGGAAGG + Exonic
1089735905 11:120550144-120550166 CAGCGTCACAGGGGGAAGAAGGG + Intronic
1090146211 11:124325784-124325806 CAGCTTTCCATAGAGAAGAATGG - Intergenic
1091624380 12:2111150-2111172 AACCAGCCCATGGGGAAAAATGG - Intronic
1092130231 12:6106422-6106444 CAGGAGCCCAGAGGGAAGAATGG + Intronic
1092153509 12:6267366-6267388 GAGCTGCCCAGAGGGAAGGAAGG + Intergenic
1093036105 12:14333924-14333946 GAGGTGACCTTGGGGAAGAATGG - Intergenic
1095119061 12:38392634-38392656 AAGCTGAGGATGGGGAAGAAAGG + Intergenic
1095371085 12:41468151-41468173 TGGCTGCGCATAGGGAAGAAAGG + Intronic
1095925817 12:47578119-47578141 CAGCTGGTCAAGGGGAAGACAGG + Intergenic
1097157286 12:57022251-57022273 TAGCTGGCCTTGGGGGAGAATGG - Intronic
1098209806 12:68151722-68151744 GAGGTGCCCATGTGGAAGAATGG - Intergenic
1098239887 12:68456218-68456240 CAGGAGCCCGTGGGGAAGACTGG - Intergenic
1098749647 12:74278080-74278102 CAGGTCTCCTTGGGGAAGAATGG - Intergenic
1102527031 12:113519716-113519738 TGGCTGCCCCTGGGGAAGATGGG - Intergenic
1104357272 12:128098951-128098973 CAGCTGCCCAGGAGAGAGAAAGG - Intergenic
1108069169 13:46609876-46609898 CAGCTGCCTACGGGCAGGAAGGG + Intronic
1108530374 13:51322469-51322491 CAGCTGCCTCTGGGGTATAATGG - Intergenic
1109983123 13:69936954-69936976 CAACTGCCCGTGGAGAATAATGG + Intronic
1112094872 13:96121473-96121495 CACCTGCCCAAAGGGAAGGAGGG - Intronic
1112308140 13:98293793-98293815 CTCCTGCCCACTGGGAAGAAAGG + Intronic
1112669522 13:101618558-101618580 CAGATGACCTTTGGGAAGAATGG + Intronic
1113549975 13:111185181-111185203 GAGCTTCCCATCAGGAAGAAGGG + Intronic
1113789729 13:113021992-113022014 CAGCTGCCCAGGGGAGAGGATGG - Intronic
1114568259 14:23647942-23647964 CAGCTGCCCATGGAGATGGGTGG - Intergenic
1117181914 14:53200273-53200295 CAGAGGCCCAGGGGGAAAAAGGG + Intergenic
1117797059 14:59405647-59405669 CAGCTTCCCTTGGCTAAGAAAGG + Intergenic
1118488746 14:66238604-66238626 CAGCTTAACATGGGGAAGACTGG - Intergenic
1118566033 14:67142124-67142146 TAGATGTCCATAGGGAAGAAAGG + Intronic
1119168440 14:72514805-72514827 CCGCTGCCCTTGGGGAGGAGCGG + Intronic
1121235575 14:92389425-92389447 AATCTGTTCATGGGGAAGAACGG - Intronic
1121755098 14:96395592-96395614 CAGCTGCTCAGGAGGCAGAATGG + Intronic
1122287733 14:100661864-100661886 CAGCTGGCCCTGAGGAAGGAAGG + Intergenic
1122319483 14:100845251-100845273 CAGCTGCCTATGGAGCGGAAGGG - Intergenic
1122821805 14:104350504-104350526 CGGCTGCCCAGGGTGAAGATAGG - Intergenic
1126478047 15:49087883-49087905 CAGATGCCCATGAATAAGAATGG + Intergenic
1126630132 15:50726067-50726089 CAGCTCCCCATGAGAAAGTAAGG - Intronic
1127533724 15:59869806-59869828 AAGCTGACCCTGGGGATGAATGG + Intergenic
1128675632 15:69606569-69606591 GAGCACCCCCTGGGGAAGAAGGG + Intergenic
1128819193 15:70636880-70636902 TAGCTGGCCAGGGGGAAGCAGGG - Intergenic
1129029224 15:72606386-72606408 CAGGTGGCCATTTGGAAGAATGG + Intergenic
1129037157 15:72657430-72657452 CAGGTGGCCATTTGGAAGAATGG + Intronic
1129212730 15:74079796-74079818 CAGGTGGCCATTTGGAAGAATGG - Intronic
1129397669 15:75261290-75261312 CAGGTGGCCATTTGGAAGAATGG + Intronic
1129401280 15:75285567-75285589 CAGGTGGCCATTTGGAAGAATGG + Intronic
1129729871 15:77924117-77924139 CAGGTGGCCATTTGGAAGAATGG - Intergenic
1129838647 15:78729865-78729887 CAGGTGGCCATTTGGAAGAATGG + Intergenic
1131055424 15:89371843-89371865 CAGATGCCAAGGGGGAAGGAAGG - Intergenic
1131225163 15:90618554-90618576 CAGCTTCCCTCTGGGAAGAAAGG - Intronic
1131290601 15:91103644-91103666 CAGCTGTCCTTGGTGCAGAAGGG + Intronic
1132367794 15:101270120-101270142 CTGAGGCCCCTGGGGAAGAAGGG - Intergenic
1133447938 16:5878168-5878190 CAGCTGGACATGTGGATGAAGGG + Intergenic
1136390819 16:29963132-29963154 CAGTTGCCCATGGGGAGCAGAGG - Exonic
1137681553 16:50350887-50350909 CAGAAGCTCTTGGGGAAGAAGGG + Intronic
1138520122 16:57566223-57566245 CTGTTCCCCATGGGGAGGAAGGG + Intronic
1138553457 16:57759350-57759372 CAGCTGCCCCGGGGGTAGAAAGG - Intronic
1138877517 16:60970725-60970747 CAGTTGCCTATGAGGAAGCAGGG + Intergenic
1139267220 16:65651283-65651305 CAGCTTCCCATGGGAAGGAATGG - Intergenic
1139990040 16:70933163-70933185 CAGCTGGGGATGGGGAAGAAAGG + Intronic
1140410427 16:74737724-74737746 CACCTGCCCCTGGGGCAGAAGGG - Intronic
1141409116 16:83820582-83820604 CTGCTGCCCCTGTGGAAGGAAGG + Intergenic
1141859427 16:86706420-86706442 CTTCTTCCCATGGGGAAGGAGGG - Intergenic
1141878378 16:86841888-86841910 CAGGTGCCCAGGGAGGAGAATGG - Intergenic
1143373777 17:6455684-6455706 CAGCAGCGCAGGGGGAAGAAGGG + Intronic
1143586602 17:7853633-7853655 GAGCTGCCAATGGGGTGGAAGGG - Exonic
1143720803 17:8807723-8807745 AAGCTGCAGATGGAGAAGAAGGG + Intronic
1145058059 17:19716082-19716104 CACCTTCGCAGGGGGAAGAAGGG - Intronic
1145145708 17:20477601-20477623 CAGCTGCTCAAGGGGAGGACTGG - Intergenic
1146787148 17:35730596-35730618 CAGGAGCCCATGAGGAAGCATGG - Intronic
1146821053 17:35983996-35984018 AAGCTGCCTCTGTGGAAGAAAGG - Intronic
1147993828 17:44350759-44350781 GAGCTGCCCAGTGGGAAGTATGG + Exonic
1148351850 17:46946980-46947002 CTGCTGCCCCTGGGGAAGGTGGG + Intronic
1150478361 17:65490793-65490815 CAGGTGCCCATGGGAGAGCAAGG - Intergenic
1151708565 17:75785863-75785885 CAGGAGCCCATGGGGATGAGAGG - Intronic
1154267565 18:12892310-12892332 CAGCTGCTCATGGGGTACACAGG + Intronic
1155558735 18:27051561-27051583 CAACTGCCAATGAGGAACAAAGG + Intronic
1156005690 18:32438425-32438447 CAGCTGCCTCTAGGGCAGAAGGG - Intronic
1156381437 18:36565056-36565078 CAGTTGCCCTTGGGGAAAACTGG + Intronic
1157331217 18:46705155-46705177 CAGCTGCCAAATGGGGAGAAAGG - Intronic
1157859650 18:51129375-51129397 CAGTTGCCCTTGGGGAAGGGTGG + Intergenic
1158304316 18:56088001-56088023 CAGTTGTCCATGGGGAATCATGG + Intergenic
1159314186 18:66749813-66749835 CAGCTGCCAAGGGTAAAGAATGG + Intergenic
1160955984 19:1691908-1691930 CAGGTGCCCATGAGAAGGAAGGG + Intergenic
1161502297 19:4623014-4623036 CTGCTGCCCGTGATGAAGAATGG + Intergenic
1162088450 19:8262278-8262300 CAGTTGCCCAGAGGGAAGAAGGG - Exonic
1162885790 19:13696166-13696188 CATCTACCCAAGGGGAAGGAGGG - Intergenic
1163168607 19:15515089-15515111 CAGCTGCCTTTGGGGAAGAAGGG - Intronic
1163733135 19:18961769-18961791 CAGCGGCCCATAGGGAGGAGTGG + Intergenic
1164990269 19:32677570-32677592 TAGCTGCTCTTGGGGACGAATGG - Exonic
1165446484 19:35859639-35859661 CAGCTGGCCCTGGGAAAGAGGGG + Intronic
1165483840 19:36083333-36083355 CTGCTGCCCATTGGGAATGAGGG + Intronic
1166763176 19:45237119-45237141 AAGGTGAACATGGGGAAGAATGG + Intronic
1168002825 19:53463171-53463193 GAGCTTCCCATGGGGAAGCCGGG + Intergenic
925050028 2:806241-806263 CAGCTTCCCCTGGAAAAGAATGG + Intergenic
927511996 2:23649712-23649734 CCGCTGCCGATGGGGATGAGAGG + Intronic
927560016 2:24063733-24063755 CAGGTGCCCTTGGGAAAGAGTGG + Intergenic
929282955 2:40102617-40102639 CAGCTGTCTGTGAGGAAGAAAGG + Intronic
934107270 2:88706841-88706863 CAACTCCCCATTGGGAAAAATGG + Intronic
936397927 2:112143155-112143177 CAGGTGGTCATGGGGAAGGAAGG + Intronic
937267138 2:120623667-120623689 CACCTGTCCCTGGGGATGAAGGG + Intergenic
937316131 2:120933139-120933161 CAGCTGCACGTGGGGAAGGCAGG + Intronic
937348341 2:121142419-121142441 CAGCTGGCCATGGGTGAGACTGG + Intergenic
937779873 2:125824898-125824920 CAGCTGGTCATTTGGAAGAAAGG - Intergenic
937804843 2:126127311-126127333 CAGCTTTCCAAGCGGAAGAAAGG + Intergenic
938275359 2:130015758-130015780 CAGCTGCCAATGGGGTAAAAGGG - Intergenic
938440002 2:131321515-131321537 CAGCTGCCAATGGAGTAAAAGGG + Intronic
938709626 2:133965040-133965062 CAGCTCCACATGGGGATGACCGG + Intergenic
940720778 2:157279725-157279747 CAGCTTCCCTTGGCTAAGAAAGG + Intronic
942202220 2:173582828-173582850 GCTCTGGCCATGGGGAAGAATGG - Intergenic
945330544 2:208535175-208535197 CAACTGCAAATGGGGAACAAAGG - Intronic
945505426 2:210634571-210634593 CAGCTGCCAATGGAGAAGTCTGG - Intronic
945947325 2:216006853-216006875 CAGGTGCCAGTGGGAAAGAAGGG - Intronic
946416597 2:219543185-219543207 CCGCTGCCCAGGGGGTAGAGCGG + Intronic
946537677 2:220648843-220648865 GAGCTGCCCTTTGGGATGAAAGG - Intergenic
947784830 2:232807604-232807626 GAGCAGCCCAAGAGGAAGAAGGG - Intronic
948306601 2:236952806-236952828 CAGCTACCCCTGGGGAGGGAGGG + Intergenic
948374834 2:237514538-237514560 TGGCTGGCCTTGGGGAAGAATGG + Intronic
1169137879 20:3208733-3208755 CTTCTGCCCATGGACAAGAAAGG - Intergenic
1169940017 20:10926749-10926771 CAGCTGTCCATGGGGATGAGGGG + Intergenic
1172015279 20:31869642-31869664 CAGCTGCCCTGGGGGTGGAAGGG - Intronic
1172135110 20:32681475-32681497 CAGCTGGCTCTGGGGAAGGAAGG - Intergenic
1172240822 20:33411460-33411482 CAGGAGCAGATGGGGAAGAAAGG - Intronic
1172882384 20:38210566-38210588 CTGCATCCCCTGGGGAAGAAGGG - Exonic
1174238569 20:49114618-49114640 CAGCTGCCTGTGGGGAAGAAGGG - Exonic
1174480250 20:50826214-50826236 AATCTGGCCTTGGGGAAGAAAGG + Intronic
1175400927 20:58699445-58699467 CAGCCGTCCCTGGGGGAGAAGGG + Intronic
1175963838 20:62650300-62650322 CAGCTGGGCTTGGGGAAGAAGGG - Intronic
1178344256 21:31811404-31811426 CAGCTGCCCAAGGGAGAGACAGG + Intergenic
1178860787 21:36287333-36287355 AAGCAGCCCATGGTGAGGAATGG - Intronic
1179567794 21:42260077-42260099 CAGCAGCTCATGGGGCAGGAAGG + Intronic
1179589736 21:42398607-42398629 CAGCTCCCCACGGGGTAGCAGGG + Intergenic
1180046271 21:45307232-45307254 CAGCTGCCCATGGCACACAAAGG + Intergenic
1180151684 21:45951429-45951451 TAGGTGCCCATGGGGAAGACAGG - Intergenic
1180305373 22:11068642-11068664 GAGTTCCCCAAGGGGAAGAAAGG + Intergenic
1181484796 22:23223896-23223918 CGGCTCCCCATGGGGAGGCAGGG - Intronic
1181565745 22:23736186-23736208 CAGCTGACCACTGGGAAGACAGG + Intergenic
1182983999 22:34699376-34699398 GAGCTGACCATGGTTAAGAATGG - Intergenic
1183041095 22:35178550-35178572 CAGCTCCCTATGAGGAAGACAGG - Intergenic
1183086267 22:35489212-35489234 CAGCAGCCCGTGGGGGAGAAGGG - Intergenic
1184846893 22:47093501-47093523 CAGCTGCCCATCGGAAAGGCTGG + Intronic
1185145522 22:49133543-49133565 CATCAGCCCAAGGGGAAGCAGGG - Intergenic
949776578 3:7639294-7639316 CGGCTGCGCATGGGCAAGATGGG - Intronic
951506223 3:23447954-23447976 CAGCTGCATGTGAGGAAGAAAGG + Intronic
951693460 3:25421040-25421062 CTGCTGCCCCTGTGGAAGACAGG - Intronic
952298503 3:32083367-32083389 CACCTGTCCATGGGGAAGAAGGG + Intergenic
953145595 3:40271605-40271627 CAGCTTCCCTTGGGAAGGAAAGG - Intergenic
953260902 3:41338264-41338286 CTGCTGCAGATGGGGCAGAACGG + Intronic
953757784 3:45662605-45662627 CAGCTGCCCTAGGGAAGGAAGGG - Intronic
954220437 3:49150323-49150345 CAGCTGCCCATGCAGGGGAAAGG + Intergenic
954398009 3:50303236-50303258 CAGTGGCTCATGGGGAAGCAGGG - Exonic
954488365 3:50876543-50876565 CAGCTGCATTTGGGGAAGAGGGG + Intronic
956773370 3:72545770-72545792 CAGGGTCCCATGGGGAAAAATGG - Intergenic
957377320 3:79375350-79375372 CAGCAGCCCAAGGGGACGGATGG + Intronic
958736402 3:98014470-98014492 GAGCTGCCTTTGGGTAAGAAAGG + Intronic
959170860 3:102842189-102842211 CAGCTTCCCTTGGCTAAGAAAGG + Intergenic
960329380 3:116339528-116339550 CACTTTCCCATGGGGAAGTAGGG + Intronic
963269329 3:143270149-143270171 CAGCTGCCCATCTGAAAGGAGGG - Intronic
966060736 3:175751251-175751273 TAGCAGCCCATGGGGAAAAATGG + Intronic
966824793 3:183954475-183954497 CAGCTGACCGTGTGGAAGACAGG + Intronic
969319777 4:6404707-6404729 CAGGTGCCCATGAGGAAGCAGGG + Intronic
969510950 4:7617673-7617695 GAGTTGGCCATGTGGAAGAAGGG + Intronic
969958444 4:10917158-10917180 CAGATGCCCATGCAGAAGAATGG + Intergenic
970806025 4:20033047-20033069 CAACTGCCCTGGGGGAAGAAAGG - Intergenic
971168855 4:24212811-24212833 CAGCTTTCCTTGGGTAAGAATGG - Intergenic
971980131 4:33741305-33741327 TGGCTGCCCATGGGGAATGATGG - Intergenic
972289123 4:37674808-37674830 CATCTACGCATGGGGAAGGAAGG + Intronic
972332538 4:38077299-38077321 CAGCTGCCAAGAGAGAAGAAAGG + Intronic
972696493 4:41451558-41451580 CAGCACTCCATGGGGGAGAAGGG - Intronic
974364345 4:60926961-60926983 CAGCTGCTTCTGGGGCAGAAAGG - Intergenic
974528546 4:63077268-63077290 CAGCTTCCCTTGGCTAAGAAAGG + Intergenic
975186972 4:71414750-71414772 CAGCTGCCATTAGGAAAGAAAGG - Intronic
975291049 4:72678539-72678561 CAGCAGCCCCTGTGGAAGTAGGG + Intergenic
976137870 4:81958563-81958585 CAGCTACCCCTGGGGGAGATGGG + Intronic
976457041 4:85260114-85260136 AACCTGCCCCTGGAGAAGAATGG + Intergenic
976506495 4:85853383-85853405 CAGCTTCCCTTGGCTAAGAAAGG + Intronic
976655277 4:87482204-87482226 CCACTGACCATTGGGAAGAATGG + Intronic
976788117 4:88845685-88845707 CAGTTACCCCTGGGGGAGAAAGG + Intronic
977739827 4:100465927-100465949 CAGCTGCCCTGGGAAAAGAAAGG + Intronic
978197166 4:105984963-105984985 CAGCTGCCCTTGGCTAGGAAAGG + Intronic
978831827 4:113095992-113096014 CAGAGCACCATGGGGAAGAAGGG - Intronic
980152437 4:129063561-129063583 CAGCCAGCCATGGGGAAGGAGGG + Intronic
981254757 4:142648405-142648427 CAGCTTCCCTTGGGTAGGAAAGG - Intronic
981859137 4:149333710-149333732 CTGCATGCCATGGGGAAGAATGG + Intergenic
982475287 4:155843010-155843032 CACCTGCACATTGGGAGGAAGGG - Intronic
983589771 4:169395775-169395797 AAAATGCCCCTGGGGAAGAAAGG - Intronic
985286277 4:188339325-188339347 CAGCTCCCTATGGGAAACAATGG + Intergenic
985331806 4:188845413-188845435 AGGCTGCCCATGTTGAAGAAAGG - Intergenic
986877150 5:12125866-12125888 CAGCTGCCCTTGGCTAGGAAAGG - Intergenic
987176881 5:15321079-15321101 CAGCTGCTCCTGGAGAATAATGG - Intergenic
988462129 5:31449280-31449302 CACATGCACATGCGGAAGAAAGG - Exonic
990347686 5:54885554-54885576 CAGCTGGCCTTGTGGATGAATGG - Intergenic
991406129 5:66302543-66302565 CTGCTGCCCATGGGGAACCAAGG - Intergenic
992333954 5:75746216-75746238 CAGCTGCCCATGGTGGAGGCTGG - Intergenic
996100409 5:119439383-119439405 CAGCTTCCCTTGGCTAAGAAAGG - Intergenic
996343333 5:122462512-122462534 GAGCTGTCCATGGGCAAGAAAGG - Intronic
997239505 5:132295998-132296020 CAGATGCCCATGGGGCACACTGG + Intronic
998158587 5:139800118-139800140 CAGCTGCCCCTGTGGAAGCCAGG + Intronic
998158884 5:139801950-139801972 CAGCGGGCCATGGGCAAGAGAGG + Intronic
998473138 5:142398903-142398925 CAGGTTCCCAGGGGGAACAAGGG - Intergenic
999197503 5:149792376-149792398 CAGCTCCCCAGAGGCAAGAAGGG + Intronic
999717443 5:154372741-154372763 CGGCAGCCCCTGGGGCAGAATGG + Intronic
999868340 5:155726450-155726472 CAACCGCCCTTGGTGAAGAATGG - Intergenic
1000414156 5:160965769-160965791 CAGCTGCACATTGAGAAAAAAGG + Intergenic
1000702977 5:164476156-164476178 CTGTTAACCATGGGGAAGAAGGG - Intergenic
1001827853 5:174760508-174760530 CAGCAGCCCCAGGGAAAGAAAGG + Intergenic
1002068566 5:176664991-176665013 CAGCGGCTAATGGGGATGAATGG + Intergenic
1002338418 5:178496368-178496390 CAGCTGCCCATGAGAAAGAAGGG + Intronic
1002705337 5:181157439-181157461 CACCTCCCCATGGGAAAGACTGG + Intergenic
1003520443 6:6854130-6854152 CAGGTGTCCATGGTGATGAAGGG + Intergenic
1005893789 6:30161270-30161292 CAGCTGGCCATATGGCAGAAAGG - Intergenic
1006257899 6:32845625-32845647 CAGCAGCTCATGGAGAAAAAGGG - Exonic
1006673170 6:35742737-35742759 CAGCTGCCCATGGGGAAGGCAGG - Intronic
1007180158 6:39923747-39923769 GAGCTGGCCATGGGGCAGGAGGG + Intronic
1007223251 6:40295264-40295286 CATGTGCCCAAGGGGATGAAAGG + Intergenic
1007820102 6:44554778-44554800 GACCTGCCCATGGGGCAGAGTGG - Intergenic
1008155443 6:48008627-48008649 TAGTTACCCATGGCGAAGAACGG + Exonic
1008767974 6:54942701-54942723 CAGCAGCCTATGGGTAAGAGGGG - Intergenic
1011814078 6:91168080-91168102 CTGATGCCCATCGGGAAGCAGGG - Intergenic
1011887808 6:92119339-92119361 CAGGTGCACATGGGGAACTATGG + Intergenic
1013980291 6:116121138-116121160 CAGGTGCCAAAGGGGAACAAGGG - Exonic
1014294646 6:119603690-119603712 CAGTTACCAATGGGGCAGAATGG - Intergenic
1015275063 6:131375667-131375689 CAGAGGTCCATGGGGGAGAAGGG - Intergenic
1016391505 6:143579991-143580013 CAACAGCCCATGGGGAACTAAGG - Intronic
1016833620 6:148455943-148455965 CAGCTGCCCTGGGGGCAGCAGGG - Intronic
1018301779 6:162410450-162410472 CTGCCTCCCTTGGGGAAGAAGGG + Intronic
1019210119 6:170397996-170398018 CTGAGGCCCAGGGGGAAGAAAGG - Intronic
1019504955 7:1386092-1386114 CAGCTGCCCTTGGCAGAGAAAGG + Intergenic
1019549162 7:1593700-1593722 CTGCTGGCCAAGGGGAAGGAAGG + Intergenic
1022333194 7:29399261-29399283 CAGCAGCCCATGTTGAAGGAAGG + Intronic
1023066079 7:36379006-36379028 CAGCTGCCCTTGGCTAGGAAAGG + Intronic
1023481790 7:40642883-40642905 CAGCTGCCCATTGTGACAAATGG + Intronic
1023981094 7:45070454-45070476 CAGTGGCAGATGGGGAAGAATGG + Intronic
1025005538 7:55351449-55351471 CAGCTGCCCAGAGCCAAGAAGGG + Intergenic
1027343299 7:77232754-77232776 CAGCTGCCCATGGGGAAGAAGGG + Intronic
1029181412 7:98704487-98704509 CAGTTGCCCATGGGGGAGCCTGG + Intergenic
1032267207 7:130378040-130378062 CTGCTCCCCATGGGGAAGGAAGG - Intergenic
1033351338 7:140564906-140564928 GGGCTGCCCATGGGTAAGAGAGG - Intronic
1035418044 7:158705435-158705457 CAGCTGCCCATAGGGTGGAGAGG + Intergenic
1035426717 7:158783022-158783044 CACGTGTCCATGGGGAAGGAGGG - Intronic
1036993352 8:13626070-13626092 CAGCTGACATGGGGGAAGAAAGG - Intergenic
1037050169 8:14362602-14362624 CAGCTTCCCTTGGGTAGGAAAGG + Intronic
1038450686 8:27637198-27637220 CAGCTGGCCGTGGGGCAGGAGGG - Intronic
1038563427 8:28599908-28599930 CAGCTGCATTTGGGGTAGAAGGG + Intergenic
1038894499 8:31766916-31766938 CAGATGACCATGTGGAACAAAGG - Intronic
1040946762 8:52893023-52893045 GAGTTGCCCAGCGGGAAGAACGG + Intergenic
1042425955 8:68649057-68649079 CAGCTTCCCATGGGAAGGAATGG + Intronic
1043792388 8:84488535-84488557 AAGCAGCCTATTGGGAAGAAAGG - Intronic
1044053886 8:87543250-87543272 CAGCTGCAGATGGGGAGGCATGG - Intronic
1044463229 8:92471960-92471982 CAGCTGTCCATGCTGTAGAAGGG + Intergenic
1045952414 8:107866360-107866382 CAGGGGCCCTTGGGGAAGGAAGG - Intergenic
1046082484 8:109388256-109388278 CAGCTCCCCAAGGGCAACAAAGG + Intronic
1047283176 8:123463713-123463735 CAGCAGCTAAGGGGGAAGAAAGG + Intronic
1047508021 8:125495212-125495234 CCGCTGCCCTTGGGGTGGAATGG - Intergenic
1049056936 8:140244165-140244187 CCGCTGCCCAAAGGGAAGGAAGG + Intronic
1049246601 8:141566052-141566074 CAGGCAACCATGGGGAAGAAGGG - Intergenic
1049312021 8:141938339-141938361 CAGCCACCCATGGGGAAGGTCGG + Intergenic
1049780939 8:144428599-144428621 GAGCTGCCGATGGGGACGGAGGG - Intergenic
1049830942 8:144700414-144700436 CCGGTGCCCATGGGGAAGCCTGG - Intergenic
1050263234 9:3863014-3863036 CAACTGCAGAGGGGGAAGAAAGG + Intronic
1050847433 9:10239893-10239915 CAGCTGGCTTTGGGGAAAAAGGG - Intronic
1053158499 9:35796778-35796800 CACCTTCCAATGGGGAAGCAGGG + Intronic
1053563073 9:39216333-39216355 CAGCTGCCCCTGTGGAAAACTGG + Intronic
1053828863 9:42054277-42054299 CAGCTGCCCCTGTGGAAAACTGG + Intronic
1054134074 9:61402722-61402744 CAGCTGCCCCTGTGGAAAACTGG - Intergenic
1054601696 9:67133175-67133197 CAGCTGCCCCTGTGGAAAACTGG - Intergenic
1056447593 9:86680894-86680916 CTCCTGCCCATGGTGAAGAAAGG - Intergenic
1056844005 9:90021897-90021919 CAGATGCTCATGGTGAAGACAGG - Intergenic
1057445416 9:95111197-95111219 CAAATGACCTTGGGGAAGAAGGG + Intronic
1057844825 9:98515254-98515276 CAGCTCCCCATGGGCAAGTTTGG - Intronic
1057928190 9:99171063-99171085 CAGTTGCCCTGGGGAAAGAAGGG - Intergenic
1057943027 9:99301459-99301481 CACATGCCCTTAGGGAAGAAGGG + Intergenic
1058476783 9:105342672-105342694 CAGATGCCCATGCTGAACAATGG - Intronic
1058896324 9:109403867-109403889 CAGGTTCCCCTGGGGAAGATGGG + Intronic
1059511397 9:114851542-114851564 CAGCTAATCAAGGGGAAGAAGGG + Intergenic
1186134180 X:6501779-6501801 AAGCAGCCCATGAAGAAGAAAGG - Intergenic
1186473071 X:9836226-9836248 CAGCTGCCCTTGGGTAAAAGTGG + Intronic
1186525606 X:10245227-10245249 CAGCTGCCAATGGGGGAAGACGG + Intergenic
1186789732 X:12985305-12985327 CAGCTGGACATGGGGAGGAAAGG - Intergenic
1188006369 X:25018133-25018155 CAGCTGCACAAGGGGGAGGAGGG - Intergenic
1188823838 X:34805772-34805794 CAGCAGCACATGGTGGAGAAGGG - Intergenic
1192561859 X:72132455-72132477 CAGTAGCCCATGGGGAAACAAGG + Intergenic
1192614882 X:72609258-72609280 ATGCTGCTCATGGGGAATAAAGG - Intronic
1192677532 X:73214316-73214338 CCGCTGGGCTTGGGGAAGAAGGG - Exonic
1196498528 X:116350786-116350808 CAGAGGCCTATGGGGAAAAATGG + Intergenic
1197838686 X:130722266-130722288 ATGCTGCCCCTGGGGAAGCAAGG - Intronic
1200236318 X:154469498-154469520 CAGGTGGCCCTGGGGAGGAATGG - Intronic
1201333504 Y:12853442-12853464 CAGCTTCCCTTGGCTAAGAAAGG + Intronic