ID: 1027347427

View in Genome Browser
Species Human (GRCh38)
Location 7:77275707-77275729
Sequence TAGGAGGCCCAGGAAAATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027347427_1027347437 27 Left 1027347427 7:77275707-77275729 CCATGATTTTCCTGGGCCTCCTA 0: 1
1: 0
2: 3
3: 22
4: 190
Right 1027347437 7:77275757-77275779 AAAATCAACAATAAAACAAATGG 0: 1
1: 0
2: 14
3: 335
4: 3031

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027347427 Original CRISPR TAGGAGGCCCAGGAAAATCA TGG (reversed) Intronic
901028176 1:6290304-6290326 CAGCAGCCCCAGGAAACTCATGG + Intronic
902230791 1:15026175-15026197 TAGGAGGCCCCAGAAAATACAGG - Intronic
903422217 1:23226146-23226168 TAAGTGCCCCAGAAAAATCAGGG + Intergenic
904962980 1:34349356-34349378 TAGGAGGCCCTGGAAAACCAGGG + Intergenic
905733683 1:40312455-40312477 CAGGAGGTCCAGCAAAACCAGGG + Exonic
907243407 1:53092872-53092894 CAGGAGCCCCAGGAAGCTCAGGG - Intronic
907677278 1:56530127-56530149 AAGGAAGCCTAGGAAATTCAAGG - Intronic
908085176 1:60624569-60624591 TTGAAGGCCCAGGAATGTCAGGG + Intergenic
908329350 1:63055447-63055469 TAGAAGGCCAAGGACAACCAGGG - Intergenic
911866664 1:103034294-103034316 TAGGAGTCCCAGAAAAAGTAAGG - Intronic
913578014 1:120196956-120196978 GAGGAGGCCCAGGGAACTGACGG + Intergenic
913630158 1:120701396-120701418 GAGGAGGCCCAGGGAACTGACGG - Intergenic
914559930 1:148808376-148808398 GAGGAGGCCCAGGGAACTGACGG + Intronic
914612903 1:149321839-149321861 GAGGAGGCCCAGGGAACTGACGG - Intergenic
920058014 1:203206635-203206657 GAGGAGGCCTAGGAAAAGCACGG + Intergenic
920388586 1:205584850-205584872 CAGGAGGCACAGGAAGAACAGGG - Intronic
1063411418 10:5839562-5839584 TAGGAGGCCGAGGAGGGTCAGGG - Intronic
1065883397 10:30057603-30057625 TGGCAGGCCCAGGAGAATTAGGG - Intronic
1067830560 10:49609339-49609361 GAGGAGGCTCTGGAAAATGAGGG + Intronic
1072157517 10:92737432-92737454 CAGGAGGCTCAGGAAGGTCATGG + Intergenic
1074343406 10:112656607-112656629 TGGGAGGCCGAGGCAGATCAAGG - Intronic
1078874568 11:15379920-15379942 TAGGAGTCCAAGGAAAGCCAAGG - Intergenic
1079407723 11:20160304-20160326 GAGGAGGCCGGGGAACATCATGG + Exonic
1079561695 11:21829397-21829419 CAGGAGGGCCAGGAAACTCTAGG - Intergenic
1081287219 11:41285694-41285716 TATGAAACCCAGCAAAATCAGGG - Intronic
1081684413 11:45032007-45032029 TAGAAGGCCCACGACCATCAAGG + Intergenic
1088724133 11:112619605-112619627 TAGGAGGCCCAGCAAAGGCAGGG + Intergenic
1088756342 11:112888403-112888425 TGGGAGGCACAGGAAAAGTAGGG + Intergenic
1089297675 11:117479976-117479998 TAGGAGGCCCTGGAAAAGCTTGG - Intronic
1089544557 11:119213179-119213201 TAGGAGGCACAGGGAAGGCAAGG - Intronic
1090835201 11:130448972-130448994 TAGGATGCCCAGCAGAAGCATGG - Exonic
1091667034 12:2426521-2426543 TAGGATGCCCATGAAAATTGTGG + Intronic
1092818437 12:12331340-12331362 GAGGAGGACCAGGCAAATTAAGG + Intronic
1093310561 12:17577282-17577304 TAGGAGCCTCAGGAGAGTCATGG - Intergenic
1097777297 12:63663402-63663424 TAAAAGGCCCAGGTAAAACATGG + Intronic
1107348690 13:39490849-39490871 TAGGACTTCCAGGAAAATCAGGG - Intronic
1107814682 13:44233781-44233803 TAGGAGGCCCACTGAAAACAAGG + Intergenic
1108843492 13:54650589-54650611 TAGGAGTCCAGGGAAAAACATGG - Intergenic
1109327948 13:60892778-60892800 GATGAGGCCCAAGAAAAGCATGG + Intergenic
1110741496 13:79002758-79002780 AAGCAGGAGCAGGAAAATCAGGG + Intergenic
1110804612 13:79739662-79739684 TAGGAGGCCCATGGAAATCTTGG - Intergenic
1111404233 13:87781354-87781376 TGAGAAGCACAGGAAAATCACGG + Intergenic
1112728157 13:102328945-102328967 TAGGAGGCCTAGGGACATTATGG - Intronic
1113331692 13:109333647-109333669 TAGGATGCACATGAACATCAAGG + Intergenic
1115290017 14:31760241-31760263 GAGGAAGCCCAGGGAAGTCATGG - Intronic
1116261176 14:42629410-42629432 TGGGAGGACGAAGAAAATCAGGG - Intergenic
1119710174 14:76816393-76816415 CAGGAGGTCAAGGAAAGTCAAGG - Intronic
1120139123 14:80907706-80907728 TATGAGGCCCAGGAAAACCAAGG + Intronic
1120191270 14:81441919-81441941 AAGGAGACACAGAAAAATCAGGG + Intergenic
1120956700 14:90089691-90089713 CCGGAGGCCTAGGAAAATAATGG + Intronic
1123066252 14:105620958-105620980 GAGGAGGCCCAGGAGCATCGGGG - Intergenic
1123070394 14:105640010-105640032 GAGGAGGCCCAGGAGCATCGGGG - Intergenic
1123074985 14:105663670-105663692 GAGGAGGCCCAGGAGCATCGGGG - Intergenic
1123089630 14:105736798-105736820 GAGGAGGCCCAGGAGCATCGGGG - Intergenic
1123095423 14:105764958-105764980 GAGGAGGCCCAGGAGCATCGGGG - Intergenic
1124872014 15:33552813-33552835 ATGGAAGCCCAGGAAAATCAGGG - Intronic
1125909320 15:43421854-43421876 GAGGAGGCCCAGGAAAACTGAGG - Exonic
1126509955 15:49459388-49459410 TAGGAGGTTCAGAAAATTCATGG - Intronic
1128997809 15:72309672-72309694 TAGGTTGCCCAGGAAGCTCATGG - Intronic
1130192899 15:81753248-81753270 TATCAAGCCCAGGAATATCACGG + Intergenic
1130925043 15:88378979-88379001 TAGGACGCCCAGGACAAGAAAGG + Intergenic
1131565047 15:93478130-93478152 CAGCAGCCCAAGGAAAATCAAGG - Intergenic
1132415087 15:101613834-101613856 GACGAGCCCCAGGAATATCAGGG + Intergenic
1132672253 16:1106663-1106685 GAGGTGGCCCAGGAAAAGCCTGG - Intergenic
1132747492 16:1443069-1443091 TCAGAGGCCCAGGAAAGCCATGG - Intronic
1133206617 16:4237892-4237914 GGGGAGGCACAGGAAAAGCAAGG - Intronic
1133598852 16:7319592-7319614 TCTGAGGCCCAGGAAAAGCATGG - Intronic
1136772130 16:32849529-32849551 TTGAGGCCCCAGGAAAATCAAGG + Intergenic
1136898481 16:34011992-34012014 TTGAGGCCCCAGGAAAATCAAGG - Intergenic
1137517145 16:49156299-49156321 AAGAGGGCCCAGGAAAATCTGGG + Intergenic
1137569771 16:49557783-49557805 CAGGAGGCCCAGGAAAGGCCAGG + Intronic
1138330486 16:56211397-56211419 TAGGAGGCCCAGGGAGTTCTGGG - Intronic
1141164351 16:81650551-81650573 TCAGAGGCCCCAGAAAATCATGG + Intronic
1141829303 16:86500718-86500740 TGGCAAGCCCAGGAAAAGCACGG - Intergenic
1142083283 16:88162180-88162202 TAAGAGACCCAGGAAGCTCAGGG - Intergenic
1203074552 16_KI270728v1_random:1111618-1111640 TTGAGGCCCCAGGAAAATCAAGG + Intergenic
1143173746 17:4944947-4944969 TTGAAGGCCCAGGAAAAACAAGG - Exonic
1144600378 17:16607622-16607644 TGGGAGTCCCAGGACAATCCAGG - Intergenic
1146618084 17:34372546-34372568 CAGGAGGGCCATGAAAACCATGG - Intergenic
1147689617 17:42307334-42307356 CAGGTGGCCCAGGAAAGTCAGGG - Intronic
1148581574 17:48747505-48747527 CTGGAGGCCCAGGAGAAACACGG - Intergenic
1149374190 17:56027826-56027848 TTGGAGAGCCAGGAAAATTAGGG - Intergenic
1153571071 18:6474092-6474114 CAGAAGGCACAGGAAAGTCATGG + Intergenic
1153583951 18:6602375-6602397 TGGGAGGCCCACTAAAACCAGGG + Intergenic
1154290664 18:13103178-13103200 GAGGAAGCCCAGGTAAGTCAGGG - Intronic
1155133604 18:22964472-22964494 TAGGAGTTCCAGGAAAAGCAAGG - Intronic
1155497714 18:26459055-26459077 CAGGAGGCCCGGGAAAATCAGGG - Intronic
1157040551 18:44034142-44034164 TATAAAGCCTAGGAAAATCAAGG + Intergenic
1158902837 18:61982245-61982267 TAGAACTCCCAGGGAAATCAGGG - Intergenic
1161612556 19:5251246-5251268 AAGGAGGCACAGCAAAATGATGG - Intronic
1161933346 19:7355839-7355861 CAGGGGGCCCTGGAGAATCAGGG - Intronic
1163225292 19:15956436-15956458 TAGGAGGCCAAGGAATCCCAGGG + Intergenic
1163551862 19:17969825-17969847 CAGGGGGCCCAGGAAAACCCAGG - Intronic
1164523457 19:28996361-28996383 CTGGAGGCCCAGGAAAACTAGGG - Intergenic
1165902088 19:39173752-39173774 CAGGGGGCCCAGGAACAGCAGGG - Exonic
1167425199 19:49426604-49426626 AAGGAGTCCCAGGAAATTCTGGG - Exonic
1168355178 19:55695888-55695910 TGGGAGGGTCAGGGAAATCAGGG - Intronic
927698523 2:25252798-25252820 TAGGAGGCCCAGGAAGCTGTAGG + Intronic
929995629 2:46824735-46824757 TTGGAGGCCCAGAAAAATTCTGG + Intronic
930423101 2:51178144-51178166 AAGAACGCCCAGGAAATTCATGG + Intergenic
930519966 2:52453429-52453451 TAGGAGGCCCAGGTCAGGCATGG - Intergenic
931472911 2:62557345-62557367 TATGAGGCCCAGGAACATCTGGG + Intergenic
933332818 2:80916320-80916342 TAAAAGGCCCAGGAAAAACTGGG - Intergenic
933834328 2:86232973-86232995 GAGGAGGCCCTGGAAAATTCCGG - Intronic
934592049 2:95562413-95562435 TAGAGGGCCCTGGAACATCAGGG - Intergenic
934675520 2:96247061-96247083 CAGGAGGGCCTGGAACATCAAGG - Intergenic
935925817 2:108067234-108067256 CAGGAACCCCAGGGAAATCAAGG - Intergenic
936284696 2:111173158-111173180 TAGCAGGCTCAGGAAAACCAAGG - Intergenic
936842160 2:116784147-116784169 TAGCAGGCCCAGGAAACACAAGG + Intergenic
937939903 2:127277108-127277130 AAAGAGGCCCAGGGAAGTCATGG + Intronic
937963260 2:127480264-127480286 TAGGAGGGCCAGTCAAATGAAGG + Intronic
938197197 2:129338753-129338775 CTGGAGGCACAGGCAAATCAGGG + Intergenic
942689985 2:178574941-178574963 TAGGTGGCCCTGGGATATCATGG + Exonic
944757258 2:202776249-202776271 TAGGAGACGCAGGAATACCAGGG - Exonic
946241238 2:218357292-218357314 TCTGAGTCCCAGGAGAATCAAGG - Intronic
1169487637 20:6046505-6046527 TGGGAGGTCCAGGAGACTCAGGG - Intronic
1170411190 20:16093894-16093916 TAGGAGCCCCAGAATAAGCATGG - Intergenic
1173004864 20:39132576-39132598 TTGGAGGCCCAGTCAATTCAAGG - Intergenic
1173221151 20:41134240-41134262 AAGGAGGTGCAGGAAAAACAGGG - Intergenic
1173365333 20:42379970-42379992 TAGCAAGCCCACAAAAATCAAGG + Intronic
1173582185 20:44155056-44155078 CAGGAGGGCAAGGAAAATAAGGG + Intronic
1173943457 20:46931871-46931893 TAGGAGTCTCAGGAGAATTATGG + Intronic
1174180399 20:48670704-48670726 TCAGAGGCCTAGGAGAATCAAGG - Intronic
1175549919 20:59810735-59810757 TGGGACCCCCAGGAAAGTCAGGG + Intronic
1175810649 20:61855572-61855594 TAGAAAGGCCAGGAAAATCCAGG - Intronic
1176294215 21:5062142-5062164 TGGCAGGCCCAGGAACCTCAGGG + Intergenic
1177619236 21:23565350-23565372 TAGGAAACACAGGAAACTCAGGG - Intergenic
1177842626 21:26251631-26251653 CAGGAGAGCAAGGAAAATCACGG - Intergenic
1178339584 21:31774609-31774631 TAGGAGGCAAAGGAAACTGATGG + Intergenic
1179628984 21:42665330-42665352 TAGCAGCCCCAGGACACTCAGGG + Intronic
1179863044 21:44201506-44201528 TGGCAGGCCCAGGAACCTCAGGG - Intergenic
1181790564 22:25262568-25262590 CAGAAGGCCCAGAAAAATCAAGG + Intergenic
1181826374 22:25519602-25519624 CAGAAGGCCCAGAAAAATCAAGG + Intergenic
1181999194 22:26906270-26906292 TAGGATGTCCAGGAATATGAGGG - Intergenic
1183506528 22:38212307-38212329 TAAGAAGCCAAGGAAAATAAAGG - Intronic
1183705078 22:39471040-39471062 AAGGAGGCCCAGGAAAAGCCGGG - Intronic
1184177131 22:42794811-42794833 TAGCAGGCTCAGGAAAAGCCTGG + Intergenic
1184428672 22:44428342-44428364 TAGGAGGCCCCGGAAGAGGAGGG + Intergenic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
1185133678 22:49056166-49056188 TGGGAAGCCCAGGATCATCACGG - Intergenic
953125726 3:40090177-40090199 GATGAGGCCCAGAAAGATCAGGG - Intronic
953144569 3:40262544-40262566 CAAGAGGCCCAGGAAAAGCTGGG + Intergenic
964326224 3:155548941-155548963 TAGGAGGAGCAGGAAAGTCAAGG - Intronic
966282617 3:178250491-178250513 GAGTAGGCCGAGGAAGATCAGGG + Intergenic
969664238 4:8547962-8547984 GAGGAGGACAAGGAAAAGCAGGG + Intergenic
971468920 4:26998278-26998300 TAGGAGGCACAGGTAAAATAAGG - Intronic
972137860 4:35915371-35915393 TAGGAGGCCCAGGATACATATGG + Intergenic
972140218 4:35950026-35950048 TAGGAGGCAAAGCAAAAACATGG - Intronic
973075102 4:45915056-45915078 TAGGAGACACAGGAAAATTCTGG + Intergenic
973826630 4:54713884-54713906 TAATAGGCCCATGTAAATCATGG - Intronic
974020742 4:56689930-56689952 TGGGAGGACCAGGATAATAAAGG - Intergenic
976162807 4:82221189-82221211 TAAGTGGACTAGGAAAATCAGGG - Intergenic
976375575 4:84342022-84342044 AAGGAGACCAAGGAAAAGCAGGG + Intergenic
981155916 4:141434822-141434844 TAGGAGGCACTGAAAAAACATGG - Intergenic
981207384 4:142059326-142059348 TAGGAGGCCTAAGAAAAGTATGG - Intronic
988161286 5:27520813-27520835 TAGAAGGCCAAGGAAAACAACGG + Intergenic
989008801 5:36846346-36846368 CAGGAGTCTCAGGTAAATCAGGG - Intergenic
990709972 5:58569709-58569731 TTGGAGGCGCAGGAAGATGAAGG - Intergenic
991437522 5:66612042-66612064 TAGGATGCCCTAGAAAATGAGGG + Intronic
993092209 5:83440492-83440514 GAGGAGGCCCATGAGAAACAAGG + Intergenic
994598280 5:101867619-101867641 TAGGCAGCCCAAGAAAACCATGG - Intergenic
998494868 5:142579658-142579680 AAGGAATCCCAGGAAAATCATGG + Intergenic
999442280 5:151611724-151611746 GAGGAGGTCCAGGAAAGGCAAGG + Intergenic
1003889125 6:10548325-10548347 TGGGAGGCCCAGGAATATCTTGG - Intronic
1004302658 6:14472630-14472652 CAGGAGCCTTAGGAAAATCAGGG - Intergenic
1006362377 6:33593756-33593778 AAGGAGGCCCAGGACAATAGAGG - Intergenic
1006650091 6:35544523-35544545 AAGGTGCCCCAGGAAAACCAGGG + Intergenic
1007474583 6:42110272-42110294 CAGAATGCCCAGGAAAACCATGG - Exonic
1007512253 6:42382568-42382590 GTGGAGGCCTAGGAAAAACATGG - Intronic
1009632849 6:66221484-66221506 TTGCATGCCAAGGAAAATCATGG - Intergenic
1009876343 6:69510369-69510391 TAGGATGCACAGAAAACTCAAGG - Intergenic
1011774328 6:90711546-90711568 AATGAGGCCAAGGAAAAGCAGGG - Intergenic
1012626028 6:101403578-101403600 TGGGATGCCCAGCAAAATAACGG - Intronic
1013494203 6:110681753-110681775 TATGAGACACAGGAAAATAATGG - Intronic
1015156451 6:130101727-130101749 CAGGAAGGCCAGAAAAATCAGGG - Intronic
1015409254 6:132873491-132873513 TAGGAAGCACAGGGAAATCATGG + Intergenic
1017450263 6:154548481-154548503 GAGGAGGCTAAGGAAGATCAAGG - Intergenic
1022936216 7:35181056-35181078 TAAAAGGCCCAGGTAAAACATGG + Intergenic
1026474194 7:70719948-70719970 TAGGAAGACCAAGAAATTCATGG - Intronic
1027347427 7:77275707-77275729 TAGGAGGCCCAGGAAAATCATGG - Intronic
1027906318 7:84187373-84187395 TAAGAGGACAAGGAAAATCTGGG + Intronic
1029832180 7:103273768-103273790 TAAAAGGCCCAGGTAAAACATGG + Intergenic
1030621734 7:111797704-111797726 TAGAAGGCCATGGAAAATGAGGG + Intronic
1031258190 7:119483011-119483033 GAGGAGGCCTAGGTAAATCATGG - Intergenic
1031431092 7:121670420-121670442 TAGTAGGCCCTGAAAAAACACGG - Intergenic
1034820708 7:154213850-154213872 GAGGAGACCCTGGAAAAGCAGGG + Intronic
1037435185 8:18855107-18855129 CAGGATCCCCAGGAAAAGCATGG - Intronic
1039659981 8:39450705-39450727 AGGGAGGCCCAGGAAAGACAGGG + Intergenic
1039769326 8:40667707-40667729 TAAGAAGCACAGGAAACTCATGG + Intronic
1039859912 8:41448207-41448229 TTGGAGACCCAGTAAGATCAAGG - Intergenic
1040870065 8:52091618-52091640 AAGGAGGACCAGGAAATTTAGGG - Intergenic
1041741309 8:61159908-61159930 GAGAATGCACAGGAAAATCAAGG - Intronic
1043527239 8:81110939-81110961 TAAGAGGTGCAGGACAATCAGGG + Intronic
1046306237 8:112371074-112371096 TAGGAGGCCAGGGGAAATCTGGG - Intronic
1047353028 8:124094198-124094220 TGAGAGGACCTGGAAAATCAGGG - Intronic
1048250497 8:132862989-132863011 TAGGAGGCCGAATAAAATCCAGG + Intergenic
1048542964 8:135359568-135359590 TAGTAGGCCCAGTGAAATCCAGG - Intergenic
1049802703 8:144525567-144525589 TACGAGCCCCAGGGAAGTCAAGG + Intronic
1049963836 9:760982-761004 GTGGAGGCCCAGGAAAGCCAGGG + Intergenic
1051268991 9:15336568-15336590 GAGGTTCCCCAGGAAAATCAAGG + Intergenic
1053346583 9:37382835-37382857 CAGGAGGCCCTGGGAAATCTGGG - Intergenic
1055636127 9:78281143-78281165 TAGGAGGCCAAGGACCAGCAAGG - Intergenic
1059656239 9:116360219-116360241 CAGAGGGCCCAGGAGAATCATGG + Intronic
1186477165 X:9866561-9866583 TAAGAGGCAGAGAAAAATCACGG - Intronic
1187017885 X:15348595-15348617 TGGGAGGCACTGGAATATCAGGG - Intronic
1188248181 X:27859064-27859086 AAGCATGCCCAGGAAAATCCTGG - Intergenic
1188593543 X:31868690-31868712 TAGGAGACCCAGGAAACCAAGGG + Intronic
1189175720 X:38955425-38955447 TAAGAGTCCCAAGAAAACCACGG - Intergenic
1189328817 X:40130352-40130374 TTGGAGGACCAGGAAGACCAGGG - Intronic
1190333055 X:49247625-49247647 TGGGAGGCCCAGGCCAGTCAGGG - Intronic
1192144620 X:68673345-68673367 TAAGAAGCCCAGCAAAAGCAGGG + Intronic
1193348321 X:80429667-80429689 GAGGAGGCCCAGGAAAAAGAGGG - Intronic
1195701924 X:107712159-107712181 TTTGTGGCTCAGGAAAATCAAGG + Intergenic
1195754826 X:108190357-108190379 TTGGAGGACCAAGAAACTCAAGG + Intronic
1199449041 X:147958959-147958981 CAGAAGGCCCAGGAAAATGGTGG - Intergenic
1200515598 Y:4140976-4140998 CAGGAGGCAAAGGAAAAGCAAGG - Intergenic