ID: 1027350874

View in Genome Browser
Species Human (GRCh38)
Location 7:77309535-77309557
Sequence TGGTGTTTCTGGAGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 574
Summary {0: 1, 1: 0, 2: 7, 3: 69, 4: 497}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027350862_1027350874 14 Left 1027350862 7:77309498-77309520 CCCATGATATGGCTGCATGACTG 0: 1
1: 0
2: 1
3: 38
4: 192
Right 1027350874 7:77309535-77309557 TGGTGTTTCTGGAGGGAAGGGGG 0: 1
1: 0
2: 7
3: 69
4: 497
1027350863_1027350874 13 Left 1027350863 7:77309499-77309521 CCATGATATGGCTGCATGACTGT 0: 1
1: 0
2: 0
3: 43
4: 180
Right 1027350874 7:77309535-77309557 TGGTGTTTCTGGAGGGAAGGGGG 0: 1
1: 0
2: 7
3: 69
4: 497

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027350874 Original CRISPR TGGTGTTTCTGGAGGGAAGG GGG Intronic
900339776 1:2182523-2182545 TGGCTCTTCCGGAGGGAAGGCGG + Intronic
900495198 1:2973029-2973051 TGATCTTTCTGGAAGGATGGTGG - Intergenic
900525557 1:3126683-3126705 TGGTGCTTCTGGAGTGAGGGAGG + Intronic
900655875 1:3756737-3756759 TGCTCTTACTGAAGGGAAGGAGG - Exonic
900751201 1:4398946-4398968 TGTTCTTTCTGCAGGGAAAGGGG - Intergenic
900827245 1:4936694-4936716 AGGTGTTTCTGTTGGGAAGTGGG + Intergenic
900831789 1:4970649-4970671 TCGTTTTTCTGAAGGGAAAGAGG - Intergenic
901086195 1:6613729-6613751 TCGTGTCTCGGGAGGGAGGGCGG - Exonic
901086875 1:6615760-6615782 GGGTGTTTCTAGATGGAATGGGG + Intronic
901208833 1:7513077-7513099 TGGTGTCCCTGCAGTGAAGGGGG - Intronic
902081661 1:13825124-13825146 TGGTGGTTTTGGTGGGAGGGCGG + Intergenic
902378113 1:16039744-16039766 TGGTGGTGCTGGAGGGATGTCGG - Intergenic
902383202 1:16062240-16062262 TGGTGGTGCTGGAGGGATGTCGG - Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903213264 1:21830125-21830147 AGGTGACTCTGGAGGGAGGGGGG + Intronic
903443937 1:23408675-23408697 TGGTCTTTTTGGAGAGGAGGAGG + Exonic
903560081 1:24220618-24220640 TGGTGGCTCTGGGGAGAAGGTGG - Intergenic
903996208 1:27306880-27306902 TGGTGGCTCTGGAGGGAGGGTGG - Exonic
904276922 1:29390909-29390931 TGTTATTTCTGCAGGGAGGGTGG + Intergenic
904504921 1:30944291-30944313 TGGTCTTTCTTTAGGGAAGGGGG - Intronic
904565980 1:31428733-31428755 TGGGGTTTCAGCAGGGGAGGAGG + Intronic
905304854 1:37010525-37010547 TGATGCTCCTGGAGTGAAGGGGG + Intronic
906144979 1:43554589-43554611 TGGGTTTTCTGGAGGGCAGAGGG + Intronic
907314049 1:53557145-53557167 TGGTGTTTCGGGAGGTGAGAGGG - Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
909426226 1:75528069-75528091 TAGTGTTCCCAGAGGGAAGGAGG - Intronic
910129557 1:83887139-83887161 TGGTGTTTCTGGAGGTAGACAGG + Intronic
910200177 1:84690665-84690687 GGGTTTTTTTGGAGGTAAGGAGG - Intronic
910236333 1:85040002-85040024 TGGTGTTTTTCGAGGGGTGGCGG - Intronic
911997751 1:104788349-104788371 TGATGCTGGTGGAGGGAAGGAGG + Intergenic
912703908 1:111897954-111897976 CCGTGTTTATGGAAGGAAGGTGG - Intronic
912723443 1:112039191-112039213 TGGTGGTTCAGGAGGGAAGCAGG - Intergenic
912726791 1:112065721-112065743 TGATTTTTCAGCAGGGAAGGTGG - Intergenic
913453780 1:119010292-119010314 TGGTAGTTCTGGAGAGAATGTGG - Intergenic
913672114 1:121106703-121106725 TGCTGTTTCAGGGGGGCAGGCGG + Intergenic
914023879 1:143894061-143894083 TGCTGTTTCAGGGGGGCAGGCGG + Intergenic
914662368 1:149802099-149802121 TGCTGTTTCAGGGGGGCAGGCGG + Intronic
914703815 1:150155599-150155621 CGGGGTGTCTGGAGGGAACGAGG - Intronic
915530142 1:156498607-156498629 TGGTCTCTCTGGGGGGAAGGGGG - Intronic
916446870 1:164880741-164880763 TAGTGTGTCTAGAGGGAAGTAGG + Intronic
916573323 1:166046047-166046069 AGGGGTTTCTGAAGGGAATGGGG - Intergenic
917129927 1:171730731-171730753 TGGTGGTTCTGGGGGCAAGGAGG + Intronic
918958135 1:191237047-191237069 TTGTATCTCTGGAGGGATGGTGG + Intergenic
919417983 1:197335175-197335197 TAGTGTGACTGGAGTGAAGGAGG + Intronic
919483635 1:198119778-198119800 AGGTGGTTATGGAGAGAAGGAGG - Intergenic
919896698 1:202013479-202013501 TGGTGGTCCTGGAGAGGAGGAGG + Intronic
920030838 1:203036539-203036561 TGGTGTGTGTGGAGGGGTGGGGG + Intronic
920137022 1:203778242-203778264 GGGTGCTTCTAGAGGGAAGGAGG - Intergenic
920260926 1:204687133-204687155 TGGGTTGTCTGGAGGGTAGGGGG + Intergenic
920433008 1:205930684-205930706 TGGTGTGGCTGGAGGGTAGAGGG - Intronic
920930961 1:210387486-210387508 TGGAGCTTCTGGATGGAATGGGG + Exonic
922376364 1:224971769-224971791 TGGTGTTCCTGGAATGAAGTTGG + Intronic
922850315 1:228727726-228727748 TGCAGTTTCTGGAGGGAAGTAGG + Intergenic
922946794 1:229523255-229523277 TAGCGTTCCTGGAGGAAAGGAGG - Intronic
1063606005 10:7523550-7523572 TGGTTTTTCTGGCGGTAAAGGGG - Intergenic
1064103464 10:12482282-12482304 GGGTGGTTCTGGAGGGAATGAGG + Intronic
1064149738 10:12852720-12852742 TGGTGTCTGTGGTGGGGAGGGGG + Intergenic
1065037892 10:21659343-21659365 TGGTCATTCTGGAGAGAAGAAGG - Intronic
1066434722 10:35386857-35386879 TGGTTTTTATGGAGGGGTGGGGG + Intronic
1066782088 10:38962218-38962240 GGGTATTTCTGAAGGGAAGAGGG - Intergenic
1068058061 10:52035309-52035331 TGGTGTGTAGGGAAGGAAGGGGG + Intronic
1068078239 10:52285129-52285151 TGGTGTGTATGCATGGAAGGGGG - Intronic
1068303753 10:55177736-55177758 AGCTTTTTCTGGAAGGAAGGTGG - Intronic
1068997670 10:63225989-63226011 GAGTGTATGTGGAGGGAAGGGGG - Intronic
1069826628 10:71258742-71258764 TGGTGACTCTGGAGGCAAGTGGG - Intronic
1070057527 10:72950023-72950045 GAGTGTTTCTGGGAGGAAGGAGG - Intronic
1070895328 10:79979286-79979308 TGGTGTTCCTGCAGGGCATGGGG - Intronic
1070939263 10:80328915-80328937 TACTGTGGCTGGAGGGAAGGAGG - Intergenic
1071388596 10:85147085-85147107 TTGTGTTTTTGGTGGGAAGTTGG - Intergenic
1071504676 10:86225492-86225514 GTGTATTTCTGCAGGGAAGGAGG + Intronic
1071506259 10:86233617-86233639 TGTTCCCTCTGGAGGGAAGGAGG - Intronic
1072697779 10:97616779-97616801 TGGTGTTTCTGCAGGTATGAGGG - Exonic
1073128466 10:101168338-101168360 AGGTGTCTATGGAGGAAAGGGGG - Intergenic
1073729451 10:106271540-106271562 TGTTGTCTCTGGTGGAAAGGAGG - Intergenic
1074575983 10:114669801-114669823 TGTTGTGGCGGGAGGGAAGGGGG + Intronic
1076054847 10:127364080-127364102 GGGTGTTTGTGGAGTGCAGGGGG + Intronic
1076873522 10:133205015-133205037 TGGTGATTCTGGGGGTGAGGAGG - Intronic
1077332336 11:1989137-1989159 GGGTGTGTCTGGAGAGAAGGGGG + Intergenic
1077546098 11:3170700-3170722 TGGTGGTGCTGGAGGCAAGGAGG + Intergenic
1077762615 11:5119442-5119464 GGGTGTTTGTGGAAGGCAGGTGG + Intergenic
1078088930 11:8251765-8251787 TGGTGTGTGTGGAGGGGTGGAGG + Intronic
1078335803 11:10462402-10462424 TAGTGTTTCTGGAGCCAAGGTGG + Intronic
1078831824 11:14984794-14984816 TGGTGAAACTGGAGGGAAGTAGG - Intronic
1079039054 11:17045185-17045207 TGGTGAGACTGGAGGGAAGTAGG + Intergenic
1080203911 11:29706914-29706936 TGATGTATGTGTAGGGAAGGTGG + Intergenic
1080576980 11:33609088-33609110 TGGTCTTTCAGAAGGGAACGTGG - Intronic
1080699199 11:34630179-34630201 TTGTGTTTCTAAAGAGAAGGAGG - Intronic
1081999436 11:47385521-47385543 TGTTATTTCTAGAGGGAAGTAGG - Intergenic
1082818716 11:57528911-57528933 TGGTCATTCTGGAGGGAGGGAGG + Exonic
1083377726 11:62239508-62239530 TGGTGTTTCTGATGGGCAGGAGG - Intergenic
1083416589 11:62529778-62529800 TGGTGTTTCAGGACCCAAGGTGG - Exonic
1084372998 11:68756830-68756852 TGGTGTTTCTGAGGGGGAGGGGG + Exonic
1084404684 11:68964415-68964437 TTGTGATGCTGGCGGGAAGGTGG + Intergenic
1084957166 11:72697597-72697619 TGGTGCTGGTGGAGCGAAGGAGG - Exonic
1085023959 11:73225852-73225874 TGGGCTTTCTGGAGGGATGGTGG + Intronic
1085746355 11:79117890-79117912 AGGTATGTCTGAAGGGAAGGGGG - Intronic
1086111179 11:83200098-83200120 GGGTGATTTTGGAGAGAAGGGGG + Intronic
1086838357 11:91653774-91653796 TGGTGTTCCTGCAGGGTGGGTGG + Intergenic
1087394459 11:97579807-97579829 TGGGGTTTCTGGGGGGATGGTGG - Intergenic
1088205363 11:107386601-107386623 TGGTGTTTCAGGAGACAGGGAGG - Intronic
1089218266 11:116849148-116849170 TGGTGTCTCTGGAGGGCCCGGGG + Exonic
1089389250 11:118088838-118088860 TGGAGTTAATAGAGGGAAGGAGG - Intronic
1089562381 11:119350542-119350564 AGGGGTTTCTGGAGGAAAGGAGG + Intergenic
1089609072 11:119659484-119659506 GGGTGGTGCTGGAGGGATGGAGG + Intronic
1089665209 11:120013850-120013872 TGGTGATGCTGGTGGAAAGGGGG - Intergenic
1090150560 11:124379303-124379325 TGGTGTGTCTGTATGGTAGGGGG - Intergenic
1090499357 11:127246763-127246785 TTTTGTTGGTGGAGGGAAGGGGG + Intergenic
1090645380 11:128763132-128763154 TTGTGTCTCTGGTGGGAAGGAGG + Intronic
1091006698 11:131960261-131960283 TTGTGATTCTGGATGGACGGAGG - Intronic
1202815318 11_KI270721v1_random:44313-44335 GGGTGTGTCTGGAGAGAAGGGGG + Intergenic
1091401402 12:182697-182719 TAGGGTTTCTTGAGGAAAGGAGG - Intergenic
1091675364 12:2485200-2485222 TGGCTCTGCTGGAGGGAAGGAGG + Intronic
1091787854 12:3253762-3253784 TGTTTGTTCTGGAGGGAATGTGG + Intronic
1092182017 12:6452476-6452498 TAGTGTGTGTGGAGGGAGGGTGG + Intronic
1092563251 12:9638191-9638213 GGGTTTTTCTGGGGGGGAGGTGG - Intergenic
1092675209 12:10909945-10909967 TGGTGCCTATGGAGGGATGGTGG - Intronic
1093289692 12:17304568-17304590 TCCTGTTTCTGAAGAGAAGGAGG + Intergenic
1093854499 12:24084010-24084032 TGGTGTTTCTGCAGTGCAAGAGG + Intergenic
1095964336 12:47857041-47857063 TGGGGCTGCTGGATGGAAGGAGG - Intronic
1096515522 12:52153166-52153188 TGGTGTCTCTGAGGGGAAGCCGG + Intergenic
1096523442 12:52197013-52197035 TGGTGTTACTGGAGTGTTGGAGG + Intergenic
1098658697 12:73067125-73067147 TCGTGTATCTGGAGGGACTGTGG + Intergenic
1099011908 12:77301481-77301503 TGGAGCTTTTGGAGGGAATGTGG + Intergenic
1100349377 12:93764315-93764337 CAGAGTTGCTGGAGGGAAGGGGG + Intronic
1100591047 12:96029943-96029965 TGGAGTTTAAGGAAGGAAGGAGG - Intronic
1101343743 12:103865927-103865949 TGGTGTTTTTGGAGGGCTGGTGG - Intergenic
1101802751 12:108036527-108036549 TGCTGCTTCTGGATAGAAGGAGG + Intergenic
1101858455 12:108463388-108463410 TTGGGATTCTGGAGGGCAGGTGG - Intergenic
1102037936 12:109782849-109782871 TGGTGTGGCTGTGGGGAAGGTGG - Intergenic
1103518765 12:121524146-121524168 TGGGCTTTCTGCAGGGAGGGAGG - Intronic
1105426507 13:20299392-20299414 TGGTGGATCTGGAGTGTAGGGGG - Intergenic
1105623827 13:22093997-22094019 GGATGGTGCTGGAGGGAAGGTGG + Intergenic
1105673950 13:22650272-22650294 TGGTGTGGCTGTAGGGAGGGTGG + Intergenic
1106561623 13:30851634-30851656 TTGTTTTTTTGGGGGGAAGGGGG - Intergenic
1107687732 13:42920917-42920939 TGGTTTTTTTGGGGGGAAGAAGG - Intronic
1108275721 13:48807596-48807618 TGGTGTGGCTGGAGAGAAGCGGG - Intergenic
1110420940 13:75307566-75307588 TTGTGTTGCAGGAGGTAAGGTGG - Intronic
1110999150 13:82155915-82155937 TAGTGATTCTGGGAGGAAGGAGG + Intergenic
1111396027 13:87671628-87671650 TGGGGTTTCTGGGGGAAGGGGGG - Intergenic
1112083412 13:96001775-96001797 TGCTGTTTCAGGTGGCAAGGTGG - Intronic
1112358828 13:98697938-98697960 TGGTTTTTCAGGAGGAAAAGTGG + Intronic
1112493576 13:99887784-99887806 TGGTGGTTGTTGAGGGCAGGGGG + Intronic
1113120012 13:106916076-106916098 GGGTGTTTCAGAAAGGAAGGGGG + Intergenic
1113285204 13:108838906-108838928 TGGTGCTTGTGGAAGGAAGAAGG + Intronic
1113709117 13:112452530-112452552 TGGTGTTTCTGGGGGGCTGCTGG - Intergenic
1117535944 14:56703476-56703498 TGGTGTTTCAGAAGGGACAGAGG - Intronic
1117911015 14:60638035-60638057 TGGAGTTGATGGAGGGAAAGCGG - Intergenic
1119505965 14:75173342-75173364 TGGTGCCACTGGAGGGAGGGAGG + Intronic
1119753740 14:77098906-77098928 TAGTGTTTCTGGGGAGAAGGTGG + Intronic
1120452894 14:84692997-84693019 TGGTGTTTCTCAAGAGACGGTGG - Intergenic
1121416047 14:93779954-93779976 GGGTCTTTCTGGGGGGATGGAGG - Intronic
1121894507 14:97634010-97634032 AGGTATTTGTGGAGGGAGGGAGG + Intergenic
1121916237 14:97838986-97839008 TTGTTTTTCGGGAGGGAAAGAGG - Intergenic
1122355472 14:101120670-101120692 TGGTGCTTCTGGTGGGCAGGTGG + Intergenic
1124329294 15:28795371-28795393 TAGAGTTTTGGGAGGGAAGGTGG + Intergenic
1124342362 15:28898107-28898129 TGGTGCCTCTGGAGGGAATGTGG + Intronic
1125513349 15:40304470-40304492 AGGTGTTCATGGAGGGAAGAAGG - Intronic
1126143134 15:45453877-45453899 TGGTGTCTCTGGAGATGAGGGGG + Intergenic
1127110907 15:55669396-55669418 TGATGTGTCTGGAGGGCAGTAGG - Intronic
1127969580 15:63947810-63947832 TGATGCTTCTGGAGGAAAGAAGG - Intronic
1128739638 15:70074600-70074622 TGCTGGTGCTGGAGGGAAGAGGG + Exonic
1129009576 15:72403037-72403059 TGGTGTTGCTGGAGACAAGCTGG - Intronic
1129172780 15:73818061-73818083 TGGTGTTTGTGGAGGCCAGGTGG + Intergenic
1129665744 15:77578533-77578555 TGGGGATTTTGGAGGGGAGGGGG - Intergenic
1129770460 15:78200426-78200448 AGGAGATTCTGGTGGGAAGGAGG + Intronic
1130079702 15:80721839-80721861 CTTTGTTTCTGGAGGGAAGGAGG + Intronic
1130109602 15:80953708-80953730 AGGAGTTGCTGGAGGAAAGGGGG + Intronic
1130232907 15:82110073-82110095 TGGTGTGGCTGCAGTGAAGGGGG - Intergenic
1130635948 15:85620159-85620181 TGGTATTGCTGAAGGTAAGGGGG + Intronic
1131074042 15:89483793-89483815 GGGTGGTACTGGATGGAAGGAGG + Intronic
1131266562 15:90918858-90918880 AGGGCTTTCTGGAGAGAAGGGGG + Intronic
1131990527 15:98088735-98088757 TGGCGAATCAGGAGGGAAGGTGG - Intergenic
1132937309 16:2487717-2487739 TGGTGTTTGGGGATGGCAGGTGG + Intronic
1134646308 16:15870069-15870091 AGGTATTTATGGAGGGAGGGAGG - Intronic
1134848543 16:17461418-17461440 TGGTCCTCCTGGAGGGCAGGAGG + Intronic
1134875395 16:17693705-17693727 CGGTGTGCCAGGAGGGAAGGGGG - Intergenic
1135583680 16:23650431-23650453 TGGTGTGTGGGGAGGGAGGGAGG - Intronic
1138594440 16:58022327-58022349 TGGTTCTTCTGGAGAGGAGGAGG + Intergenic
1138763320 16:59570026-59570048 TGATGTTTCTTGAGGGAGGCAGG + Intergenic
1139515652 16:67451007-67451029 TGGTGTTTAAGACGGGAAGGTGG + Intronic
1140452427 16:75081460-75081482 TTTTGTTTCTTGAGGGAAAGTGG + Intronic
1140537814 16:75727024-75727046 AGGTTTTTCTGGAGGGAAGCGGG + Intronic
1142252842 16:89000656-89000678 TGGTCCATCTGGAGGGATGGCGG - Intergenic
1142964694 17:3573286-3573308 GGGTGGTCCTGGAGGGAAGAAGG - Intronic
1144147331 17:12411470-12411492 TGAGGTTTCTGGAGAGGAGGTGG - Intergenic
1144147739 17:12414292-12414314 TGAGGTTTCTGGAGAGGAGGTGG + Intergenic
1144214228 17:13040765-13040787 TGGTGCTTCAGGAGGGCTGGTGG - Intergenic
1146942233 17:36851306-36851328 TGGAGTTTTTGGGGGCAAGGAGG - Intergenic
1147166087 17:38594149-38594171 TGCTGTTTGTGCAGGGAAGCGGG + Intronic
1147448126 17:40487429-40487451 TGGAGTTGCTGGAGTGCAGGAGG + Exonic
1147485540 17:40809180-40809202 TGCTGTTTCTGGTGGGGAGGGGG - Intergenic
1148606167 17:48930605-48930627 AGGTGTTCCTGGAGGGAAAAGGG + Exonic
1148675365 17:49441763-49441785 TGGTGTGGCTGCAGGGAGGGAGG - Intronic
1149355062 17:55831138-55831160 TGCTGCTTTTGGAGGGAAAGTGG - Intronic
1150037544 17:61820262-61820284 TGGTGTTTTAGGTGGGAAGGAGG - Intronic
1150266478 17:63835377-63835399 GGGAGGTTCTGGAGGGAAGGAGG - Intronic
1150428072 17:65093208-65093230 TGGGCTTCCTAGAGGGAAGGGGG + Intergenic
1151554339 17:74839068-74839090 TGGTGCTTCTGTGGGGAGGGAGG - Exonic
1152193805 17:78904380-78904402 TGTTGTTTCTTGAGAGAAGAAGG + Intronic
1152474857 17:80511445-80511467 TGGTGTGTGTGGATTGAAGGTGG - Intergenic
1152528431 17:80902843-80902865 CAGGGTTTCGGGAGGGAAGGCGG - Intronic
1203190713 17_KI270729v1_random:184996-185018 GGGTATTTCTGAAGGGAAGAGGG - Intergenic
1154387081 18:13903694-13903716 GGGTGGTTCTGGAGGGAGGTGGG + Intronic
1157446417 18:47749595-47749617 TGGGGTTGATGGAGGGAAGGAGG + Intergenic
1158644990 18:59237888-59237910 AGATTATTCTGGAGGGAAGGAGG + Intergenic
1158849641 18:61482525-61482547 TAGTGTTTCTGGAGAGAAGGTGG - Intronic
1160018745 18:75164332-75164354 TGCTGTTTCTGGAGCGCAGAGGG + Intergenic
1160901018 19:1428772-1428794 GGGTGTGTCTAAAGGGAAGGGGG + Intronic
1162011703 19:7820332-7820354 TGATGTTTCTGTGGGGAACGCGG - Intergenic
1162228558 19:9245410-9245432 TGGTGAAACTGTAGGGAAGGAGG + Intergenic
1162423771 19:10581627-10581649 TGATGTACCTGGAGGGAGGGCGG + Exonic
1164923483 19:32107636-32107658 AAGTCTTTCTGGAGGGGAGGAGG - Intergenic
1164940465 19:32249126-32249148 TGGTTCTTCTGGAAGGAATGAGG + Intergenic
1165113345 19:33514535-33514557 GGGTGTATCTGGAGGGCAAGTGG - Intronic
1165269248 19:34690601-34690623 TGGTGTTTCTGTAGGGAGGAGGG + Intergenic
1165490869 19:36121895-36121917 GAGTGTTTGTGGAGGGAAGTGGG + Intronic
1166143980 19:40821874-40821896 TGGGGTTTCTGGGGAAAAGGAGG + Intronic
1166183629 19:41125222-41125244 TGGGGTTTCTGGGGAAAAGGAGG - Intronic
1166302870 19:41922076-41922098 TGGTGATGCTGGAGGGGCGGGGG + Intronic
1166303472 19:41924828-41924850 CGGTGTTTCTGGAGAGAAGCAGG + Intronic
1166567985 19:43776695-43776717 TGGTGGTTTTGAAGGAAAGGTGG - Intronic
1166842917 19:45709878-45709900 TAGTGCTTCTGGGAGGAAGGGGG + Intergenic
925067771 2:941973-941995 TGGTGGTTCTGGTGGGCAGGGGG - Intergenic
925104421 2:1278317-1278339 TGCTGTTTATGGAGGGTACGAGG + Intronic
925290099 2:2741957-2741979 TGGAGTTTGTGGAGAGAATGGGG + Intergenic
925533250 2:4887438-4887460 GGGTGTGGCTGGAGGGGAGGAGG + Intergenic
925769287 2:7266628-7266650 CACTGTATCTGGAGGGAAGGAGG - Intergenic
926210334 2:10864496-10864518 TGGCCTTTCTGTAGGGAAGGAGG + Intergenic
927107351 2:19839624-19839646 TGGTGTGGGTGGAGAGAAGGGGG - Intergenic
929643499 2:43604903-43604925 TGGTGTGTGTGGAAGGAAGAGGG - Intergenic
930424277 2:51193892-51193914 TGGAGTTACTGGAGGGAGGGTGG - Intergenic
930851511 2:55965936-55965958 AGGTGTGTGTGAAGGGAAGGAGG + Intergenic
931057946 2:58493879-58493901 TGATGTTTCTTGAGAGAAGAGGG + Intergenic
931546198 2:63390719-63390741 TGGTATTTCTGTAGGATAGGTGG - Intronic
932688104 2:73890796-73890818 TGGGGATTCTGGAGGGAAGAGGG - Intergenic
933014258 2:77104389-77104411 TGGGGATTCTGGTGGGAAAGTGG - Intronic
933898952 2:86835658-86835680 TGGTGTTGGTGGAGGGGTGGAGG - Intronic
934529582 2:95076748-95076770 GGGTGTTCCGGGAGGGAGGGAGG - Intergenic
934721354 2:96579088-96579110 TGGTGCTTTTGAAGAGAAGGTGG - Intergenic
935316429 2:101839252-101839274 TGGTTCTTTTGGAGGGATGGAGG - Intronic
935547099 2:104412116-104412138 TTGTGTTTTTGGTGGGGAGGCGG - Intergenic
935781594 2:106513568-106513590 TGGTGTTGGTGGAGGGGTGGAGG + Intergenic
935989226 2:108704551-108704573 TGGTGTTCCTGCAGGGCAGAGGG - Intergenic
936139836 2:109929849-109929871 TGGTGTTTCTGGAGTGGTGGAGG - Intergenic
936139846 2:109929906-109929928 TGGTGTCTCTGGAGTGGAGGAGG - Intergenic
936139856 2:109929963-109929985 TGGTGTTTCTGGAGTGGTGGAGG - Intergenic
936204840 2:110441523-110441545 TGGTGTTTCTGGAGTGGTGGAGG + Intronic
936204850 2:110441580-110441602 TGGTGTCTCTGGAGTGGAGGAGG + Intronic
936204860 2:110441637-110441659 TGGTGTTTCTGGAGTGGTGGAGG + Intronic
936888576 2:117342065-117342087 TGGTGTTTTAGGATAGAAGGAGG - Intergenic
937136739 2:119559913-119559935 TGGTGTTCCTGGAAGACAGGTGG - Exonic
937206466 2:120239849-120239871 GGGAATTTCTGGAGGGAGGGGGG + Intergenic
937453555 2:122022531-122022553 TGGACTTTCTGAAGGGAAGATGG + Intergenic
937862827 2:126724398-126724420 GTGTGTTTGTGGAGGAAAGGAGG - Intergenic
937916403 2:127101182-127101204 GGGTGTTTGTGCAGGGCAGGTGG - Intronic
939110360 2:137999403-137999425 TGGTGTGTGTGGAGGGAAGGAGG - Intronic
940173869 2:150857738-150857760 AGGTGTTTCTGAAGGAAATGGGG + Intergenic
940285109 2:152026259-152026281 TGAAGATTCAGGAGGGAAGGAGG - Intronic
940659662 2:156531259-156531281 TGGTGTTAGTGTTGGGAAGGGGG + Intronic
941017287 2:160371826-160371848 TGGGGCTTCTGGCGGGAAGGAGG - Intronic
941297350 2:163756815-163756837 TGGTGATTCTGGAGGCAACCAGG - Intergenic
941918397 2:170827115-170827137 GGCTATTTCTGGAGGGAAGAAGG - Intronic
943299463 2:186179790-186179812 TTGTGCTTCTGGATGGATGGTGG - Intergenic
945683895 2:212946053-212946075 TGATGTTTTTGGAGGGCTGGGGG - Intergenic
945762281 2:213928441-213928463 TGAAGTTTCTGGAGAGAAGGTGG - Intronic
945805372 2:214483959-214483981 TAGAGTTTCTGGAGGGAAGATGG - Intronic
945964554 2:216172260-216172282 TGGAGTGTCTGGTGGAAAGGAGG + Intronic
946174836 2:217916285-217916307 TGGGGGGTCTGGAGGGGAGGAGG - Intronic
946694201 2:222335811-222335833 TGGGATTTCTGAAGGGAAAGAGG + Intergenic
946723127 2:222632514-222632536 TTGCGTTTCTGGAGGTAAGAAGG - Intronic
948051911 2:234984991-234985013 TTGTCTTTCTGGAGGCCAGGAGG + Intronic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948768220 2:240233986-240234008 TGATGTTTCTGGGGGGGAAGGGG + Intergenic
949061397 2:241960020-241960042 TGGTGTTTGTGGAGAAAAGCTGG - Intergenic
1169105200 20:2988494-2988516 TGGTGTATCAGCAGGGAAGAAGG + Intronic
1169213858 20:3782834-3782856 TCGGATTTCGGGAGGGAAGGTGG + Intergenic
1169218755 20:3808355-3808377 AGTAGTGTCTGGAGGGAAGGGGG + Intergenic
1170188552 20:13620001-13620023 TAGAGTTTTGGGAGGGAAGGTGG - Intronic
1170564634 20:17591106-17591128 TGGTTTTTCTGGGGGGGAAGGGG - Intronic
1170614643 20:17938875-17938897 TGATGTGTCTGGAAGGAAGTTGG - Intergenic
1173723383 20:45279529-45279551 TGGTGTTTGGGGAGGAGAGGAGG - Intergenic
1174183382 20:48688918-48688940 TGGTGGTGGTGGAGGGCAGGTGG - Intronic
1174335518 20:49857148-49857170 TGGAGTTTTTTGCGGGAAGGTGG - Intronic
1175482394 20:59320822-59320844 TGGGGGTTGTGGAGGGCAGGGGG + Intronic
1175978981 20:62727634-62727656 TGGATTTCCTGGAGGGGAGGCGG + Intronic
1176049215 20:63107828-63107850 TTGTTTTACTTGAGGGAAGGTGG + Intergenic
1178074897 21:29005912-29005934 TGGTGTTTATGGCAGTAAGGGGG + Exonic
1178300673 21:31450249-31450271 TGTTGTTTCTGTAGGGAAGTTGG - Intronic
1178307231 21:31500924-31500946 TGGTTTTTGTAGAGGGGAGGAGG - Intronic
1178484434 21:33009057-33009079 TGGTGTTTGTCGGGGGAGGGAGG - Intergenic
1178640823 21:34343718-34343740 TTATTTTTCTGGATGGAAGGGGG - Intergenic
1179832605 21:44006922-44006944 TGTTCTTTCTGGAGGAAGGGAGG - Intergenic
1179987526 21:44929978-44930000 TGGGGTTTCTGGTGGGAACTGGG - Intronic
1181730554 22:24843313-24843335 ATGTGTTTCTGCAGAGAAGGTGG + Intronic
1182213889 22:28699926-28699948 TTGTGTTTCAGGATGGAAGGGGG - Exonic
1182390654 22:29992391-29992413 TGGTTTTTTTGGGGGGGAGGGGG - Intronic
1182758363 22:32699520-32699542 TGGTGTGTGTGCAGGGATGGGGG + Intronic
1183343029 22:37292527-37292549 CTGGGTTTCCGGAGGGAAGGGGG + Intronic
1183483475 22:38077248-38077270 GGGAGTTTGCGGAGGGAAGGCGG + Intergenic
1183966305 22:41444925-41444947 TGGGGTTGCTGGATGGACGGTGG + Intronic
1183992192 22:41604915-41604937 TCTTGTTTCTAGAGGGGAGGGGG + Intronic
1184642918 22:45881669-45881691 TGGTGTTCCTTGAGGGGAGGAGG + Intergenic
1185025765 22:48410934-48410956 TGGGGTTTCTGCAGGGAAGGAGG + Intergenic
1185070643 22:48654004-48654026 CGGCGGCTCTGGAGGGAAGGGGG + Intronic
1185322233 22:50206883-50206905 TGGTGCTTCTGGGGGGGAGGGGG + Intronic
949105108 3:194216-194238 TGATGGTTCAGGAGGGAGGGAGG + Intergenic
949306542 3:2648111-2648133 TGGTGGTTCTGAAGGCAAAGTGG - Intronic
949747179 3:7308485-7308507 TTATGTGTCTGGAGGGATGGAGG + Intronic
949875862 3:8625640-8625662 TGTTCTTCCTGGAGGGAAGGAGG + Exonic
953560144 3:43982745-43982767 TGGGGGTGCTGGAGGGGAGGTGG - Intergenic
953930952 3:47005409-47005431 TGCTGTGGCTGGAGGGAAGAAGG - Intronic
954077289 3:48190296-48190318 TGTGGTTTGTGGAGGGATGGTGG + Intergenic
954478658 3:50775745-50775767 TGGACTTGCTGGAGGGAGGGTGG - Intronic
954654600 3:52186280-52186302 TGGTGTAGCTGGTGGGAAGGGGG - Intergenic
955405530 3:58623418-58623440 TGGAGCTTCTGCAGGGCAGGAGG - Intronic
955512843 3:59698609-59698631 TGGGGTTTCTGCATGGTAGGGGG - Intergenic
955538211 3:59947332-59947354 TGGTATTTCTGGGGGGTTGGTGG + Intronic
956339220 3:68203138-68203160 TGTAGTTTCTGAAGGGAAGTTGG + Intronic
956807227 3:72827533-72827555 AGGTGTTTTTGGTGGGGAGGGGG - Intronic
957072911 3:75580072-75580094 GGCTGTTGCTGGAGGGAGGGGGG - Intergenic
957540831 3:81566780-81566802 TCTTTTTTCTGGGGGGAAGGAGG + Intronic
957687443 3:83520361-83520383 GTGTGTTTCTCGAGGGAAAGGGG - Intergenic
962355920 3:134694161-134694183 TGAGGTTACTGGAGGTAAGGTGG + Intronic
964745933 3:160012538-160012560 AGGGCTTTCTGGGGGGAAGGTGG - Intergenic
965196613 3:165605488-165605510 GGGTTTTTTTGGGGGGAAGGGGG - Intergenic
965742530 3:171890721-171890743 TGGTGTTCCTGGGAGGAGGGAGG + Intronic
965919534 3:173895570-173895592 TGGTCTTTCTGGAAGCTAGGAGG - Intronic
966868509 3:184275894-184275916 CGGTGTTGCTGGAGGGCAGCTGG + Intronic
967598388 3:191355454-191355476 TGATTTACCTGGAGGGAAGGAGG + Intronic
967741734 3:193010480-193010502 CTGTGTTCCTGGAGGGAATGTGG + Intergenic
968317020 3:197733634-197733656 TTGTGTATCTGGAGCTAAGGAGG + Intronic
968478570 4:824262-824284 TGGTGTTCCTGGCGGGACAGGGG - Intronic
969892636 4:10273984-10274006 TGGCCTTTCTGGGGAGAAGGCGG + Intergenic
970090713 4:12404520-12404542 CAGTTTTTCTGGAGGCAAGGTGG - Intergenic
970731565 4:19110370-19110392 TGGTGTCTCTGCAGGAGAGGAGG - Intergenic
970785983 4:19796861-19796883 TGGTGTTTCTGAGGAGAAGGAGG + Intergenic
971246191 4:24930330-24930352 TGGTGCTTCTGAATGGTAGGTGG - Intronic
972204615 4:36757362-36757384 TGGTGTGTCTGGAGAGAAGGAGG - Intergenic
974218992 4:58941390-58941412 TTATGTTTCTGGAGAGCAGGTGG - Intergenic
974678855 4:65135475-65135497 TTGTGTCTCTGGAGGTGAGGTGG - Intergenic
975545881 4:75560105-75560127 TGGTTTTTGGAGAGGGAAGGAGG + Intronic
976142233 4:82004252-82004274 TGGTGTTCGTCGAGGGAAGCAGG + Intronic
976167146 4:82268238-82268260 TGGGGTTTCTGGAGAGAGGAAGG - Intergenic
976517239 4:85982923-85982945 TGGTGTTTGTTGGGAGAAGGGGG - Intronic
977526415 4:98151615-98151637 TGGTGGATGTGGAGGGGAGGGGG + Intergenic
978258133 4:106717899-106717921 TGGTGTTCCTGGGGGCACGGTGG - Intergenic
979690116 4:123550724-123550746 TGGTCTACCTGGAGGGAATGAGG + Intergenic
979701573 4:123674091-123674113 TGGTGTGAGTGGAGGGGAGGAGG - Intergenic
980062471 4:128146618-128146640 TGGTTTTTCTGGAGAGAAGGAGG + Intronic
980988381 4:139717604-139717626 AGGTGTTTTTGGAGAGGAGGCGG - Exonic
981625337 4:146748191-146748213 TGGTGTATCTCCAGGGAAGAAGG - Intronic
982278815 4:153663386-153663408 TGGTGATGATGGAGGGAATGTGG + Intergenic
983144467 4:164196810-164196832 TGGGGGTTGTGGAGGGAGGGAGG - Intronic
983292732 4:165826508-165826530 TGGGGTTTTGGGAGAGAAGGCGG - Intergenic
983503248 4:168524668-168524690 TGGTGTTTCTGATGGTCAGGAGG - Intronic
984121570 4:175751570-175751592 TGGGGTTTCTGGAGAGAGAGAGG + Intronic
985127309 4:186707544-186707566 TGCTGTTTCTGGAGGAAATGAGG - Exonic
985689955 5:1302271-1302293 TGGTGGTTCTAGAGGGGTGGGGG - Intergenic
986167097 5:5283470-5283492 TGGGCTTTCTGGGGGGGAGGTGG - Intronic
986731200 5:10636158-10636180 AGGTGTTCCTGGGGGGAGGGAGG + Intronic
986960739 5:13208568-13208590 TGGTGTTACTAGAGGGTAGGAGG + Intergenic
988474316 5:31569887-31569909 TGGCGCTTCGGGAGGGAAGGAGG - Intergenic
988481072 5:31631088-31631110 TGGTCATTCACGAGGGAAGGAGG + Intergenic
988609358 5:32710747-32710769 CGGTGCTTCAGGAGGGAATGTGG + Intronic
989807274 5:45624779-45624801 TTGTGTTTATGGAGGCAAGCAGG + Intronic
991978598 5:72208561-72208583 TGGTGTTTAAAGAGGGGAGGAGG - Exonic
992835823 5:80640319-80640341 TGGGTTTTTTGGGGGGAAGGGGG - Intronic
993133023 5:83923217-83923239 TAGAGTGTCTGGAGAGAAGGAGG - Intergenic
994925996 5:106118031-106118053 TGGTTTTTCTGTGGGGAAAGGGG + Intergenic
995111540 5:108434410-108434432 TTGTGTCTCTGGAGATAAGGGGG + Intergenic
995310668 5:110707121-110707143 TGGTGTTCCTGCAAGGGAGGAGG - Intronic
995538917 5:113165362-113165384 TGGTGTTTCTTGTAGGTAGGGGG - Intronic
996024142 5:118624905-118624927 TGGTGTGGCAGGAGGGGAGGTGG + Intergenic
997830581 5:137146245-137146267 TGGTGTTCCTGGGGAGAGGGAGG - Intronic
997833406 5:137172566-137172588 TAGTGTCTCTGGTGGGAAGGTGG - Intronic
998401865 5:141852547-141852569 GGGGGTTTCTGGAAGGAAGAGGG + Intergenic
999442808 5:151615538-151615560 TGATGTTGCTGGTGGGAGGGGGG - Intergenic
999697629 5:154200387-154200409 AGGGGCTCCTGGAGGGAAGGGGG + Intronic
999784596 5:154879894-154879916 TGGTGTTTGGTGGGGGAAGGTGG - Intergenic
1000025227 5:157353010-157353032 TGCAGTTTCTGGAGGGAATGTGG + Intronic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1000888287 5:166773534-166773556 TGGTGCTACTGCAGGGTAGGCGG - Intergenic
1001034796 5:168290118-168290140 TGGTATTTATGGAATGAAGGAGG + Intergenic
1001321867 5:170689009-170689031 TGGTAGTTTTGGAAGGAAGGAGG + Intronic
1001633631 5:173194616-173194638 AGGTGTTTGTGGAGGAAACGGGG - Intergenic
1002021508 5:176366632-176366654 TGGATTCTCTGCAGGGAAGGGGG + Intronic
1002401285 5:178992763-178992785 GGGAGTTTCTGGAAGGAGGGAGG + Intronic
1002494608 5:179603299-179603321 TGATGTCTCTGGTGGGAATGCGG + Intronic
1002846369 6:948689-948711 TGGTGGTGCTGGAGGGAATTAGG + Intergenic
1003116708 6:3288265-3288287 GGGTGTTTGGGGAGAGAAGGGGG - Intronic
1003685339 6:8296969-8296991 TGGAGTTTGTGTAGGGAAGGTGG - Intergenic
1004085997 6:12449813-12449835 TCGTAGTTCTGGAGGGTAGGAGG - Intergenic
1004980906 6:21022599-21022621 TTGTGTGTGAGGAGGGAAGGGGG + Intronic
1005261573 6:24066746-24066768 TGGAGCTTCTGGAGGGAGTGTGG + Intergenic
1005668556 6:28081507-28081529 TTGTGTTTCTCAAGGGCAGGGGG - Exonic
1005840539 6:29742275-29742297 AGGTGCTTCTGCAGGAAAGGAGG - Intergenic
1005909106 6:30292530-30292552 TTTTGTTTCTGGAGGGAAAAGGG + Intergenic
1006114965 6:31770642-31770664 AGGTGTCCCTGGTGGGAAGGTGG + Intronic
1006930634 6:37685958-37685980 TGGTGTTTCTTGAATGAAAGGGG - Intronic
1007742552 6:44021749-44021771 TGGTGCTGGGGGAGGGAAGGGGG - Intergenic
1007743123 6:44024968-44024990 TGGTGCTGGGGGAGGGAAGGGGG - Intergenic
1007770245 6:44186321-44186343 TGGTGATAATGGAGGGAAGGCGG - Intergenic
1008821107 6:55631331-55631353 TGGTGTTCCTGAAGGGTGGGTGG + Intergenic
1009641724 6:66345954-66345976 TGGAAATTCTGGAGGGAATGAGG + Intergenic
1010331659 6:74630130-74630152 AGGTGTTTGGGGAGGGAGGGAGG - Intergenic
1010445220 6:75941949-75941971 TGGTGTTTCTGGAGGCTGGGGGG + Intronic
1011559397 6:88599552-88599574 TGGTGGTTGCGGCGGGAAGGGGG + Intergenic
1011747583 6:90420987-90421009 AGGTGTTTCTAGTGGGAAAGTGG + Intergenic
1011772355 6:90688863-90688885 TTGTGTTTCTGCATGAAAGGTGG + Intergenic
1012051005 6:94343873-94343895 TTTTGTTCCTGGATGGAAGGTGG + Intergenic
1013367941 6:109448956-109448978 TGGGGGTTCTGTAGGGGAGGAGG + Intronic
1015138562 6:129902838-129902860 TGTTCTTTCTGGAGGCAATGAGG + Intergenic
1015578968 6:134702701-134702723 TGGTGTTCCTGCAGGGAGGGTGG + Intergenic
1016251220 6:142045260-142045282 TGGGGCCTCTGCAGGGAAGGGGG - Intergenic
1016591876 6:145754941-145754963 TGGTGTTTTTAGAGGCAAGATGG + Intergenic
1016705011 6:147096718-147096740 AGGTGTTCCAGAAGGGAAGGGGG - Intergenic
1016831919 6:148442542-148442564 TGGTGTATGTGGGGGGCAGGGGG - Intronic
1018150870 6:160937242-160937264 TGTTTTTTCTGAGGGGAAGGGGG + Intergenic
1018699716 6:166416720-166416742 AGGTGATTGTGGAGGGATGGTGG - Intronic
1019157806 6:170050811-170050833 TGGGTTTTCTGGAGGAAACGAGG - Intergenic
1019410095 7:902962-902984 TGATGTGCCTGGAGGGAAAGGGG - Intronic
1021097981 7:16554711-16554733 CGGTGTTTGTGAAGGTAAGGGGG - Intronic
1021434740 7:20601258-20601280 TGTTGTTTTTGGAGGGAGGAAGG + Intergenic
1021841117 7:24722755-24722777 TGGGGGTTCTGGAGGGAGGTGGG - Intronic
1022124210 7:27340137-27340159 GGGTGTTTCTGGATCTAAGGTGG + Intergenic
1023362736 7:39432610-39432632 GGATGTTGGTGGAGGGAAGGAGG + Intronic
1023897441 7:44445602-44445624 TTTTGTTTTTGGAGGGGAGGAGG + Intronic
1024740059 7:52343692-52343714 TGGTTTTACTGGAGGAAAAGAGG - Intergenic
1024807227 7:53157245-53157267 AGGTATTTCTGAAGGGAAGAAGG + Intergenic
1024855579 7:53774745-53774767 TGGTGATTTTTAAGGGAAGGAGG - Intergenic
1026171091 7:67954509-67954531 TGGTGTTTCAAGGAGGAAGGAGG + Intergenic
1027189727 7:75989600-75989622 TGCAGGTTCTGGAGGGGAGGTGG - Intronic
1027350874 7:77309535-77309557 TGGTGTTTCTGGAGGGAAGGGGG + Intronic
1027537226 7:79418634-79418656 TGGTCTTTCTACAGGGAAGAAGG + Intronic
1028169639 7:87581026-87581048 TGGTGTTCCTGTAGGGATGGGGG + Intronic
1028451663 7:90991801-90991823 TGGTGATGCTGGAGTGAAGGTGG + Intronic
1028639410 7:93026482-93026504 TGATCTTTCTGGAGGGTGGGAGG + Intergenic
1028817577 7:95164979-95165001 TGGAGTTTTTTGGGGGAAGGGGG - Intronic
1029335780 7:99898119-99898141 TGGTGGTGCTGAAGGGAAGTGGG - Intronic
1029440626 7:100585004-100585026 TGGTGTCTGTGGATGGTAGGGGG - Intronic
1029580418 7:101433474-101433496 AGGTGTTTCCAGAGGGAGGGTGG + Intronic
1029896861 7:103991705-103991727 TGGTGTTGTTAGAGGGATGGGGG + Intergenic
1030737370 7:113065561-113065583 TGGTATATCTGGAGAGAAGAAGG + Intergenic
1031147568 7:118013925-118013947 TGGTGCTTCTGGTGGCAGGGTGG - Intergenic
1031236112 7:119179850-119179872 AGGTCTTTCTAGAGGGAATGTGG + Intergenic
1031875507 7:127135468-127135490 TGTTAAATCTGGAGGGAAGGTGG - Intronic
1032260661 7:130333771-130333793 TGGTGTTTCTGGCAGGGTGGAGG + Intergenic
1033360977 7:140638923-140638945 TGGTGTTCCTGGAAGGAAGGGGG + Intronic
1033599694 7:142880196-142880218 TGGTGGTGATGGAGGGAATGTGG - Intronic
1034094409 7:148393429-148393451 TGGTGTTTTTGCAGGAAAAGTGG - Intronic
1035464086 7:159063901-159063923 TGGGGTTCCTGGAGGGATGTGGG + Intronic
1035528452 8:332894-332916 GGGTGTCCCTGGAGGGAGGGCGG + Intergenic
1035528468 8:332939-332961 GGGTGTCCCTGGAGGGAGGGCGG + Intergenic
1035702412 8:1646780-1646802 TGGTGTGTCAGGAGTGAAGGGGG + Intronic
1036738375 8:11339808-11339830 TGGAGTTTTTGGAGGGCTGGTGG + Intergenic
1038621504 8:29147794-29147816 TGCTTTTTCTGCAGGGAAGATGG - Intronic
1039954671 8:42197738-42197760 TGGTTTTTATGGAGGGAAGATGG - Intronic
1040060688 8:43100551-43100573 GGGTGCTTATGGAGGGGAGGTGG + Intronic
1041513395 8:58675249-58675271 TTCTGTTTCTGAAGGGCAGGAGG + Intergenic
1042422299 8:68605952-68605974 TGGTGTGTGTGGGGGGCAGGAGG + Intronic
1042829607 8:73012128-73012150 TTGTGTTTCAGGAGATAAGGAGG + Intronic
1042950405 8:74195668-74195690 TGATCTTCCTGGAGGGATGGAGG + Intergenic
1042985330 8:74576847-74576869 TGGTGAATCTGGAAGGAAGGTGG + Intergenic
1045445354 8:102256762-102256784 TGGGGGTGGTGGAGGGAAGGAGG - Intronic
1045595980 8:103657049-103657071 TTGTTTCTCTTGAGGGAAGGTGG - Intronic
1046819857 8:118622402-118622424 TGGTGGTTCAGGAGGCCAGGGGG - Intergenic
1047355928 8:124121566-124121588 TGGTGTTTCTGGTGTCAAGAGGG - Intergenic
1048940323 8:139394986-139395008 TGGTGTCTCTGGAGTCAAGCTGG + Intergenic
1049021334 8:139959564-139959586 GGGTGTTGGTGGTGGGAAGGTGG - Intronic
1049052579 8:140210422-140210444 TGCTGCTGCTGGAGGGAAGTGGG + Intronic
1049741055 8:144241118-144241140 TGGGGCTTCTGCAGGGAAAGCGG - Intronic
1049874684 8:145008674-145008696 TGGTGTTCCTGGTGGGTGGGAGG + Intergenic
1050348374 9:4715981-4716003 TGGGGTTTCTGGCTGGTAGGAGG + Intronic
1050464768 9:5910579-5910601 TGGGGGTTCTGGAGGGATGTAGG - Exonic
1051351643 9:16203382-16203404 TGGGCTGTCTGGAGGGAAGGGGG + Intergenic
1051371378 9:16362178-16362200 TGGAGCTTTTGGAGGGAGGGTGG - Intergenic
1051720017 9:20027642-20027664 TGAGGTTTTTGAAGGGAAGGAGG + Intergenic
1052764314 9:32625297-32625319 TGGAGTTCCAGGAGAGAAGGGGG - Intergenic
1053167812 9:35856872-35856894 TGGGATTCCCGGAGGGAAGGGGG + Intergenic
1053266912 9:36721838-36721860 TGGAGTTCCTGGAGGGCTGGAGG - Intergenic
1054986920 9:71272426-71272448 TGGTATTTCTGTAGGAAAAGCGG - Intronic
1057059856 9:91994104-91994126 TGGTGTTTTGGGATGGATGGTGG - Intergenic
1057770693 9:97965198-97965220 GGGTGTATCTGCAGGGAAGAGGG - Intergenic
1057946885 9:99338032-99338054 TGGGGTCACTGGATGGAAGGTGG + Intergenic
1059560888 9:115333631-115333653 GGGTGGTCCTGGGGGGAAGGGGG - Intronic
1059751909 9:117255621-117255643 TTCTGTTTCTTGAGGGATGGGGG - Intronic
1060301117 9:122375181-122375203 TGGTGTTTATGGAAAGAACGTGG + Intronic
1060725338 9:126002508-126002530 TGGTGTGTATGGAGGAAGGGTGG + Intergenic
1062361046 9:136188289-136188311 TGCAGCTACTGGAGGGAAGGAGG + Intergenic
1062401219 9:136373550-136373572 TGGTGTGTCTGCAGTGCAGGTGG - Exonic
1062653681 9:137590974-137590996 GGGTGTTTCTGGAGAGACAGCGG + Intergenic
1185601309 X:1341600-1341622 AGCTGCTTCTGGAGGGAAAGCGG - Intronic
1186006678 X:5079842-5079864 TGGAGATTATGGAGGGGAGGGGG - Intergenic
1186137035 X:6532819-6532841 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137058 X:6532882-6532904 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137079 X:6532941-6532963 TGGTGTGTGAGGAGGGAGGGAGG - Intergenic
1186137098 X:6533000-6533022 TGGTGTGTGAGGAGGGAGGGAGG - Intergenic
1186137108 X:6533033-6533055 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137131 X:6533096-6533118 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137166 X:6533192-6533214 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137200 X:6533285-6533307 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137210 X:6533314-6533336 TGGTGTGTGAGGAGGGAGGGAGG - Intergenic
1186137220 X:6533347-6533369 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137242 X:6533409-6533431 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137265 X:6533472-6533494 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137277 X:6533505-6533527 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137289 X:6533538-6533560 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186267153 X:7844201-7844223 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267165 X:7844234-7844256 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267187 X:7844296-7844318 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267197 X:7844325-7844347 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267209 X:7844358-7844380 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267232 X:7844421-7844443 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186297754 X:8169208-8169230 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297766 X:8169241-8169263 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297778 X:8169274-8169296 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297790 X:8169307-8169329 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297802 X:8169340-8169362 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297814 X:8169373-8169395 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297826 X:8169406-8169428 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297838 X:8169439-8169461 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297848 X:8169468-8169490 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297860 X:8169501-8169523 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297872 X:8169534-8169556 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297884 X:8169567-8169589 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297894 X:8169596-8169618 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297906 X:8169629-8169651 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297916 X:8169658-8169680 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297928 X:8169691-8169713 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297942 X:8169728-8169750 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297954 X:8169761-8169783 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297966 X:8169794-8169816 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297980 X:8169831-8169853 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186324860 X:8466568-8466590 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324894 X:8466663-8466685 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324904 X:8466692-8466714 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324953 X:8466834-8466856 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324999 X:8466960-8466982 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325012 X:8466993-8467015 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325024 X:8467026-8467048 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325056 X:8467117-8467139 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325066 X:8467146-8467168 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325095 X:8467234-8467256 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325105 X:8467263-8467285 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1187111464 X:16305258-16305280 TGGTTTTTTGGGGGGGAAGGTGG + Intergenic
1187305696 X:18093461-18093483 AGGTGTATGTGGAGGGAATGTGG + Intergenic
1187716152 X:22104432-22104454 TGGTGTTTGAGGTGGAAAGGGGG + Intronic
1189083075 X:37994732-37994754 TGGTGGTGATGGGGGGAAGGAGG + Intronic
1192863596 X:75106841-75106863 TGGTGTCCTTGAAGGGAAGGGGG - Intronic
1194657994 X:96597004-96597026 AGGTGTGTGTGCAGGGAAGGGGG - Intergenic
1194743948 X:97608239-97608261 TGGTGGTGCTTGAGGGAAAGAGG + Intergenic
1194904659 X:99559836-99559858 TTGTGTTTCTGTAGGGTTGGTGG - Intergenic
1195139991 X:101949756-101949778 AAGTGTTACTGGAGGGATGGGGG + Intergenic
1195993849 X:110711552-110711574 TGGTGTTTCTGCAGAAAATGTGG + Intronic
1196815047 X:119658249-119658271 TGGTTTTATTGGAGGGAGGGGGG + Intronic
1196987672 X:121292885-121292907 TGGTGATTCTGGAGGGAGGGGGG - Intergenic
1198688186 X:139250248-139250270 TGGTGTTTGGGGAGTGAAGATGG - Intergenic
1199845486 X:151689966-151689988 TGGAGGTTCTGGAGAGATGGTGG - Intergenic
1199905254 X:152221873-152221895 TGGGGTTTTTGGAGGGTGGGAGG - Intronic
1200932816 Y:8712413-8712435 TCCTGTTTCTGAAGAGAAGGAGG + Intergenic
1201438458 Y:13985038-13985060 TGGTGTGTAGGGAGGGAGGGAGG - Intergenic
1201438492 Y:13985154-13985176 TGGTGTGTAGGGAGGGAGGGAGG - Intergenic
1201438611 Y:13985524-13985546 TGGTGTGTAGGGAGGGAGGGAGG - Intergenic
1201438636 Y:13985609-13985631 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1201438657 Y:13985667-13985689 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1201445916 Y:14057041-14057063 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1201445937 Y:14057099-14057121 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1201445962 Y:14057184-14057206 TGGTGTGTAGGGAGGGAGGGAGG + Intergenic
1201446081 Y:14057554-14057576 TGGTGTGTAGGGAGGGAGGGAGG + Intergenic
1201446115 Y:14057670-14057692 TGGTGTGTAGGGAGGGAGGGAGG + Intergenic
1201678614 Y:16617144-16617166 TGGTGTATTTGAAAGGAAGGAGG + Intergenic
1202063177 Y:20909807-20909829 TGGTGGGTTTGGAGAGAAGGGGG + Intergenic
1202387084 Y:24336533-24336555 TGGCTGTTCTGCAGGGAAGGAGG + Intergenic
1202483702 Y:25333595-25333617 TGGCTGTTCTGCAGGGAAGGAGG - Intergenic