ID: 1027355772

View in Genome Browser
Species Human (GRCh38)
Location 7:77353509-77353531
Sequence CTGCTTTCCCTCAAGCAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027355770_1027355772 21 Left 1027355770 7:77353465-77353487 CCAAAGTAGCATTTGGACAGGTT 0: 1
1: 0
2: 1
3: 10
4: 105
Right 1027355772 7:77353509-77353531 CTGCTTTCCCTCAAGCAAAAAGG 0: 1
1: 0
2: 2
3: 24
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027355772 Original CRISPR CTGCTTTCCCTCAAGCAAAA AGG Intronic
902279908 1:15366875-15366897 CTACTCTCCCTCAAGCCAAAGGG + Intronic
902316771 1:15626430-15626452 CTGCTGTTCCTCAAACAACAGGG - Intronic
906717331 1:47979886-47979908 CTGCTCTGGCTCAAGCAAGAGGG + Intronic
907485197 1:54773109-54773131 CTGACCTCCCTCAAGCAAGAGGG - Intergenic
907554976 1:55335557-55335579 GTGCTTCCCCTCAAGCCAAAAGG - Intergenic
908838049 1:68248539-68248561 CTGGATTCCCTCACGGAAAATGG - Intergenic
911521419 1:98934742-98934764 ACTCTTTCCCTCAAGCAAAATGG + Intronic
914863405 1:151405447-151405469 CTCCTTTGCCTCTAGCAATATGG + Exonic
916157841 1:161874095-161874117 ATAATTTCCCTCATGCAAAATGG - Intronic
916283071 1:163074120-163074142 CTGCTCTCTCTAAAGCAGAAAGG + Intronic
916481305 1:165217174-165217196 CTGCTTTCTCACAAGCACACAGG - Intronic
917204496 1:172557504-172557526 CAGCTTTCTCTCAATCAAAGTGG - Intronic
917641172 1:176984464-176984486 CAGCATTTCCACAAGCAAAAGGG - Intronic
918409425 1:184243399-184243421 CTGCCTTCCCTTTTGCAAAATGG - Intergenic
919498472 1:198307595-198307617 TTGTTTTCCCTTAAGCAAATCGG - Intronic
920173035 1:204083413-204083435 CTGCTTTTCCTCAACCCACAGGG + Intronic
920265836 1:204721971-204721993 ATGCTGTCCCTCAAAGAAAAGGG - Intergenic
921745214 1:218732763-218732785 TTGACTTCCCTCAAGCAAGAAGG - Intergenic
921856362 1:219989898-219989920 CTACTTTATCTCAAGAAAAACGG + Intronic
923105146 1:230848735-230848757 CTGCTTTCCCCAAAGGAAAAGGG + Intronic
923168901 1:231394826-231394848 CTCATTTCCCTCAATCAGAATGG + Intronic
1063099708 10:2938787-2938809 CTGCTTTTCCACAACCAGAATGG + Intergenic
1064690691 10:17915197-17915219 CTGGCCTCCCGCAAGCAAAAAGG - Intergenic
1064983816 10:21190023-21190045 CTTCTTGCCCTGAAGCAAAAAGG - Intergenic
1065303842 10:24350155-24350177 CTTCTATGCCTCAAGCCAAAAGG - Intronic
1066312564 10:34211942-34211964 CTTCTTTCCATCAAGAGAAAAGG + Intronic
1067434807 10:46269296-46269318 CTTCTTTCCCTTAAGCTGAAAGG - Intergenic
1068076319 10:52259823-52259845 CTGTTTTCCCTGAAGTAAACTGG + Intronic
1068770191 10:60812096-60812118 CTGCTTTCACCCAATCAGAATGG - Intergenic
1070342732 10:75512417-75512439 ATGCTTTTCCTGGAGCAAAATGG - Intronic
1070775932 10:79109783-79109805 CTGTTTTCCCACCTGCAAAATGG + Intronic
1071269528 10:83994058-83994080 TTTCTGTCCCTCAAGCCAAAGGG + Intergenic
1072893024 10:99341737-99341759 CTGCTTTTCTTCCAGCAAAATGG + Intronic
1073575648 10:104620723-104620745 CTGCTTTACCTCTAGAAAGAGGG + Intergenic
1075661182 10:124197545-124197567 CTGCTTCTCCTCATGTAAAACGG + Intergenic
1077235027 11:1477571-1477593 CTGCCTTCCTTCCAGCAAGAAGG + Intronic
1078737330 11:14032569-14032591 CTTCTGTCCATCAAGCAAGATGG + Intronic
1079311741 11:19372612-19372634 GTGCTATCCTTCAAGCACAAAGG - Intronic
1082813095 11:57490516-57490538 CTGCTTTCCCTTGAGCAAGAGGG - Intronic
1085068848 11:73523126-73523148 CTGCTTTCTCTAGAGCAGAAAGG + Intronic
1085564623 11:77501946-77501968 CTGCTTTGCATGAAGCAAAGAGG - Intergenic
1085926391 11:81028228-81028250 CTGCTTCCCCATGAGCAAAATGG + Intergenic
1086963847 11:93007797-93007819 CTGTTTTCCCTCAGCTAAAATGG + Intergenic
1087199424 11:95330540-95330562 CAGCTTTCCCTCAGGCAGCAGGG + Intergenic
1087520818 11:99233105-99233127 CTTCTTTCCCTCAGGCTACATGG + Intronic
1087903744 11:103671698-103671720 CTATTTTCCTTCAACCAAAATGG + Intergenic
1092697697 12:11191711-11191733 CTGCCTTCCATAAAGCCAAAGGG + Intergenic
1095754658 12:45751071-45751093 CTCCTTTCCCTCACTCTAAAGGG - Intronic
1097302042 12:58029281-58029303 CTGCTTTCCCCAAAGAACAATGG + Intergenic
1097510627 12:60534804-60534826 ATGCTTTCCCTCTAGATAAAAGG - Intergenic
1098618993 12:72568305-72568327 CTTTTTTCCCCCAAGAAAAATGG + Intronic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1101518625 12:105461065-105461087 CTGTTTTCTCTTCAGCAAAATGG - Intergenic
1101934454 12:109046068-109046090 CTGACTTCCCCCAAGCAAGAGGG - Intronic
1103230261 12:119324357-119324379 CTGCTTTCTCTCTAACAGAAAGG + Intergenic
1106191597 13:27458351-27458373 CTGCTTTCCAGCCAGCAGAAAGG - Intergenic
1107258312 13:38457809-38457831 CTGATTTCCCTGAAGGAAAGTGG - Intergenic
1110116936 13:71829705-71829727 CTGCTCTCCGGGAAGCAAAATGG - Intronic
1112340020 13:98545150-98545172 CGCCTGTCCCTCAACCAAAAGGG - Intronic
1112759967 13:102684025-102684047 CGTCTTTCTCTCAAGCAAAAGGG - Intergenic
1113676744 13:112213022-112213044 TTCCTTTCCCTAAAGCAAATAGG - Intergenic
1113964649 13:114145856-114145878 TTGCTTTCCCTTCAGCAGAACGG + Intergenic
1114158740 14:20137940-20137962 ATGCTTTCACCCAAGGAAAATGG + Intergenic
1116615873 14:47137569-47137591 CTGCTTTCACTCATGGCAAAAGG - Intronic
1116633014 14:47357572-47357594 CTGCATTCCTTCAACCAGAAGGG + Intronic
1116673522 14:47874682-47874704 CTGTTTTCCATCAAGTAACATGG - Intergenic
1117712623 14:58547770-58547792 CTGCTTTCCCACCTGCACAAAGG - Exonic
1117955241 14:61117838-61117860 CTGCTGTTCCTACAGCAAAAAGG - Intergenic
1120428787 14:84387242-84387264 CTGCTTTCTCTCATGTCAAAAGG - Intergenic
1121125320 14:91403069-91403091 GTGCCCTCCTTCAAGCAAAAGGG - Intronic
1124507879 15:30294553-30294575 CTGCTTTCCCTGATGGAAGAGGG + Intergenic
1124608760 15:31193277-31193299 CTGCTTTCCCTCAGGAAAAATGG + Intergenic
1124735676 15:32244104-32244126 CTGCTTTCCCTGATGGAAGAGGG - Intergenic
1125193251 15:37017813-37017835 TTGTGTTCCGTCAAGCAAAATGG + Intronic
1125332291 15:38594094-38594116 CTGCTTTCTCTAAAGAGAAAAGG + Intergenic
1126558195 15:50014110-50014132 CTGATTTCCCACCAGCAACATGG + Intronic
1127176814 15:56366971-56366993 CAGCTATGCCTCAATCAAAACGG + Intronic
1127579701 15:60327182-60327204 ATGCATTCACTCAAGCAAACAGG + Intergenic
1128748093 15:70129121-70129143 CTGTTATCCCTAAAGCACAAGGG + Intergenic
1130726578 15:86445372-86445394 CTGCTTTGGCTGAAGCAAAAGGG - Intronic
1131197627 15:90368475-90368497 ATGCTATCCATCAAGGAAAATGG + Intronic
1132777222 16:1601547-1601569 CTGCTTTCCCTCCAGCTACGTGG - Intronic
1134344013 16:13372459-13372481 CAACTTGCCCTAAAGCAAAAGGG + Intergenic
1135067431 16:19322340-19322362 CTGATCTCCCCCAAGCAAAAAGG + Intergenic
1135162013 16:20104892-20104914 CTGCATTCCCTAAAGTAAACAGG + Intergenic
1137724634 16:50648821-50648843 CTGCTTTCCAGGCAGCAAAATGG - Intergenic
1138166784 16:54809469-54809491 CTGCCTTCCTTGAAGCTAAATGG + Intergenic
1140280587 16:73551105-73551127 CTGCTTTCCCACCAGCAAAACGG + Intergenic
1141651898 16:85397228-85397250 CTGCTTCCCCCAATGCAAAAGGG - Intergenic
1141935031 16:87232656-87232678 TTGCAGACCCTCAAGCAAAATGG + Intronic
1142229092 16:88891232-88891254 CTGCTGTTCCTCAAGCACAGCGG + Intronic
1143291625 17:5835846-5835868 TTGCTCTCCCCCAAGCAAGAGGG - Intronic
1146306583 17:31734396-31734418 CTGTTTTCCCTCCAGGAACAAGG - Intergenic
1146496418 17:33326625-33326647 CTGGTTTTCCTCAAGGGAAAAGG - Intronic
1146583228 17:34058701-34058723 CTGCATTCCCACAAAGAAAACGG - Intronic
1149253166 17:54793661-54793683 CTGCTTTCACAAAAGCTAAAGGG + Intergenic
1150729626 17:67680809-67680831 CTTCTTTGGCTCCAGCAAAATGG - Intronic
1150823628 17:68456642-68456664 CTGCTTTCTCTCCAGGAAACAGG - Intronic
1152374820 17:79913619-79913641 CGGCTTCCCCTCCTGCAAAATGG - Intergenic
1153002818 18:471935-471957 CTGCTTTGCCTCTAAAAAAAAGG + Intronic
1154100505 18:11468698-11468720 CTGCTTTCCTTCCAGGAACATGG + Intergenic
1156542936 18:37934385-37934407 CTGCTTCCACCCAGGCAAAAGGG + Intergenic
1156658643 18:39318636-39318658 CTGCTTTCCCTCTCCCAGAAAGG - Intergenic
1156822001 18:41384191-41384213 CTATTTTCCCTGTAGCAAAAAGG + Intergenic
1156956070 18:42964952-42964974 CTGTTTTTGCTCAAGCAAAATGG - Intronic
1162143552 19:8599001-8599023 CTTGTTTCACTGAAGCAAAAGGG - Intronic
1164615824 19:29666169-29666191 CTGCTTTCCCACCTGCAAAGAGG - Intronic
926804224 2:16689697-16689719 GTGCTTTCTCTCAAGCAGAAGGG - Intergenic
927092295 2:19721295-19721317 CTGACTTCCCCCAAGCAAGAGGG + Intergenic
928083309 2:28328754-28328776 CTGTTTTCTCTCCTGCAAAATGG + Intronic
928905012 2:36358204-36358226 ATGCCTTACCTCAAGAAAAATGG + Intronic
929966051 2:46537513-46537535 CTTCTTTCCTGGAAGCAAAATGG - Intronic
933300863 2:80539618-80539640 CTCCTTTCCCTCAAGATAACTGG + Intronic
937893105 2:126955273-126955295 CTCCTTTCCCTCAAACCAGAAGG + Intergenic
940382852 2:153035895-153035917 CTGCTTTCCCACTTGCCAAAAGG + Intergenic
942524819 2:176841879-176841901 CTGCTTTCACTCATGGCAAAAGG - Intergenic
944454729 2:199881254-199881276 TTACATTCCCTCAAGCAACATGG + Intergenic
944635854 2:201675382-201675404 CTGCCTTCACTCAAGTGAAAAGG + Intronic
944959128 2:204850182-204850204 CTGTTTTCCATGAAACAAAATGG - Intronic
945588835 2:211702134-211702156 TTGCTTATCCTCAAGCAACAGGG - Exonic
946059073 2:216926308-216926330 ATGCTTTGCCTCAAGGAAAAAGG - Intergenic
946851812 2:223914835-223914857 CTGCTTTAGCTGAAGAAAAATGG - Intronic
948099350 2:235361008-235361030 CTGACTTCCCTCAAGCAAGAAGG + Intergenic
948538316 2:238664562-238664584 CTCCTTTACCTCAAGCAAATGGG - Intergenic
1172964952 20:38827923-38827945 CTTCTTTCCCTCATGCTCAATGG + Intronic
1173833703 20:46111092-46111114 CTCCTTCCCCTCAAGTAAGAAGG - Intergenic
1175836242 20:61996898-61996920 CAGCTCTCCTTCAAGCCAAAAGG + Intronic
1176232864 20:64040904-64040926 CTCCTCTCCCTCATGCAGAATGG + Intronic
1177440605 21:21118494-21118516 CTGCTTTCTCTCAACCTACAAGG - Intronic
1180055518 21:45357105-45357127 CTCCTTTCCCCCAAGAAGAAGGG + Intergenic
1181033485 22:20159126-20159148 CTGCTTCCCCACAACCCAAACGG + Intergenic
1181509820 22:23384118-23384140 CTGCTTCCCCACAACCCAAACGG - Intergenic
1181596689 22:23919697-23919719 CTGCATTCCTTCAACCAGAAGGG + Intergenic
1182795190 22:32986671-32986693 CTGTTTGACCTCAGGCAAAATGG + Intronic
1183168563 22:36166634-36166656 CTGCTTTACCCCAGGCAGAAGGG + Intergenic
1183288831 22:36985237-36985259 CTGGTTTACGACAAGCAAAAGGG - Intergenic
1183661161 22:39222272-39222294 ATGCTTTCTCTCCAGCAAAGGGG + Intergenic
950454022 3:13082051-13082073 CTGCTTCCACTCAAGGATAAAGG - Intergenic
951394713 3:22151595-22151617 CTGACTTTCCTCAAGCAAGAAGG - Intronic
951813569 3:26727983-26728005 CTGCTTTTCCTCTAGCTGAATGG + Intergenic
951945352 3:28129732-28129754 CTGATGTCTGTCAAGCAAAATGG + Intergenic
953370006 3:42379518-42379540 CTACATTAGCTCAAGCAAAAGGG + Intergenic
954214482 3:49116844-49116866 CTGCTTTCTCTCCTGCCAAAGGG + Exonic
958787649 3:98615213-98615235 CTGACTTCCCCCAAACAAAAGGG + Intergenic
960171813 3:114471279-114471301 CTGTTTTCTCACACGCAAAATGG - Intronic
960735633 3:120776604-120776626 GTGCTTTCTCTCAACCAAATAGG - Exonic
963070859 3:141304175-141304197 CTCCTTTCACTCGAGAAAAAAGG + Intergenic
963525945 3:146413541-146413563 CTGCCTTCCCTAAAGCTCAAGGG + Intronic
963633908 3:147769003-147769025 TTGCTTTGCCTCAAAGAAAATGG - Intergenic
965700950 3:171459265-171459287 CTGCTTTTCCTCAATCAGACCGG - Intronic
966109935 3:176388191-176388213 CTGTTTTATCTAAAGCAAAATGG + Intergenic
966141510 3:176762338-176762360 CTGATCTCCCTCAAACAAGAAGG + Intergenic
968704400 4:2071280-2071302 CTGCCTTCCCTCATGCACAGTGG - Intergenic
970708483 4:18833903-18833925 CTGCTTTCACTCATGTAAGAAGG + Intergenic
970743585 4:19267166-19267188 CTGCTTTACCTCAGGAAAAAAGG - Intergenic
971553606 4:27983478-27983500 CTGAATTCCCTCAAGAAAACTGG + Intergenic
972516856 4:39817148-39817170 CTGCTCTCCCCAAAGCCAAATGG + Intergenic
973955146 4:56056265-56056287 CTGTTTACCCTCATTCAAAATGG - Intergenic
974641562 4:64639456-64639478 CTGTTTTCCATTAAGAAAAAGGG + Intergenic
975057204 4:69948829-69948851 CCGCTTTCCCTAACTCAAAAAGG + Intergenic
975310712 4:72900272-72900294 TTCCTTTCCTTCAAGTAAAAAGG + Intergenic
976323676 4:83747028-83747050 CTGCTTTCCCTCAGATAATACGG + Intergenic
976387868 4:84481747-84481769 CAGCTTTCTCGCAAGGAAAAAGG + Intergenic
977449502 4:97176820-97176842 CTGCTTTCACTCATGGAAGAGGG + Intergenic
978168212 4:105634231-105634253 CTGCTTTCCCTGAAGCAGGTGGG + Intronic
978323163 4:107520689-107520711 CTGCTTTACCTCAATAAGAAAGG + Intergenic
978709059 4:111755276-111755298 TGGCTTTCACTCAAGCAAACTGG + Intergenic
979578526 4:122325557-122325579 CTGCTTTCTCTTAAGTAGAAAGG + Intronic
980135660 4:128856250-128856272 CAGTTTTTCCTCAAGGAAAAAGG - Intronic
981839971 4:149100371-149100393 CTGCTTTCCCTCTAGGTAAAGGG + Intergenic
982465678 4:155727977-155727999 CTGCTTTCCAGGAAGGAAAATGG + Intronic
983882271 4:172946858-172946880 CTGCTTTTCCATAACCAAAATGG - Intronic
989403894 5:41039135-41039157 CTGCTTTCCCTGAAGGAAAGGGG - Intronic
990136608 5:52652625-52652647 CTGCATTGTCTCAGGCAAAATGG - Intergenic
992356666 5:75992253-75992275 CTGCTTCCACTTAGGCAAAATGG - Intergenic
992757955 5:79926656-79926678 CTACTTTCCTTCAGGAAAAAAGG + Intergenic
993041858 5:82823599-82823621 CTGGTTTCCTTACAGCAAAATGG + Intergenic
994652670 5:102548767-102548789 ATCCCTTTCCTCAAGCAAAAAGG - Intergenic
995182879 5:109245337-109245359 CTGTTTTCCCTCAGGAAAAGAGG + Intergenic
996737764 5:126773547-126773569 GTGATTTCCTTCAAGGAAAATGG - Intergenic
999165628 5:149546946-149546968 CTGTTTCCACTGAAGCAAAAAGG - Intronic
1001927420 5:175648564-175648586 CTGATCTCCCTCAAGCAAGAGGG - Intergenic
1004637205 6:17480430-17480452 CTGCTTTCTCTAAAGCTCAAAGG + Intronic
1007740566 6:44006987-44007009 CTGATTTCCCTCAGGAAACATGG + Intergenic
1010308703 6:74356333-74356355 TTGCTCTCCCTCAGTCAAAAAGG - Intergenic
1012592382 6:100998367-100998389 CAGCTTTCCCAGAAGCAGAAGGG - Intergenic
1013873561 6:114796863-114796885 TTGCATTCCCTCAAGCATGATGG - Intergenic
1015471084 6:133607203-133607225 CTGCATTCCCTTAAGAAAACTGG + Intergenic
1016830498 6:148428957-148428979 CTGCTATACCTCGAGCAATACGG + Intronic
1017377838 6:153791283-153791305 CTGGCCTCCCTCAAACAAAAGGG - Intergenic
1018390228 6:163336173-163336195 CTGCTTTGCTTCAAGCACATCGG + Intergenic
1019653478 7:2173454-2173476 GTGCTTCCCCTCAAGCTAACAGG + Intronic
1020289448 7:6711552-6711574 CTGCATTCCTTCAACCAGAAGGG - Intergenic
1022114339 7:27249290-27249312 CCGTTTTCCCTCCTGCAAAATGG - Intergenic
1022845789 7:34208470-34208492 CTCCTTTCTCTCTAGTAAAATGG + Intergenic
1023342552 7:39237094-39237116 CTGTTTTCCCTCAAGGCAAAAGG - Intronic
1023826490 7:44013488-44013510 CTGCATTCCTTCAACCAGAAGGG + Intergenic
1024011867 7:45273936-45273958 CTGACCTCCCTCAAGCAAGAAGG - Intergenic
1025155640 7:56603687-56603709 TTGCTTTAGCGCAAGCAAAATGG + Intergenic
1026090067 7:67292358-67292380 CTGCATTCCTTCAACCAGAAGGG + Intergenic
1026177505 7:68010671-68010693 CTGCTTCCCCTCAAGACAGAAGG - Intergenic
1027119658 7:75507677-75507699 CTGCATTCCTTCAACCAGAAGGG + Intergenic
1027272167 7:76527934-76527956 CTGCATTCCTTCAACCAGAAGGG - Intergenic
1027355772 7:77353509-77353531 CTGCTTTCCCTCAAGCAAAAAGG + Intronic
1028467126 7:91165021-91165043 CTACTGTCCCTCAAGCAGCAGGG - Intronic
1028845225 7:95472650-95472672 GTGCATAGCCTCAAGCAAAAAGG + Intergenic
1028850407 7:95531389-95531411 CTACTTTCCCTCCAGCGAAAAGG + Intronic
1029717839 7:102342351-102342373 CTGCATTCCTTCAACCAGAAGGG - Intergenic
1029754776 7:102566892-102566914 CTGCATTCCTTCAACCAGAAGGG + Intronic
1029772726 7:102665972-102665994 CTGCATTCCTTCAACCAGAAGGG + Intronic
1031117718 7:117686281-117686303 CCTTTTTCCCTCAAGCCAAATGG + Intronic
1037938735 8:22933192-22933214 CTGCTTTGCCTAAGGGAAAAGGG + Intronic
1038610231 8:29054212-29054234 CTGCTTTCCCTTCAGTAATACGG - Intronic
1039016139 8:33151074-33151096 CTGTTTGCCCTTAAGCAAAGAGG + Intergenic
1039597610 8:38805012-38805034 CTGCTATCTCTCAAGAAATAGGG - Intronic
1040541534 8:48361557-48361579 CTGCCTGCCCTCCAGCCAAATGG - Intergenic
1041036934 8:53801812-53801834 CTGCTTCCACCCAAGCAAAGCGG + Exonic
1041717138 8:60942724-60942746 CTGCCTACACTCAAGGAAAAGGG + Intergenic
1044249591 8:89990312-89990334 CTGCTTTCCTTCCAAGAAAATGG + Intronic
1044407282 8:91842764-91842786 CTGCTTTCCTTCAAGCAGGGAGG - Intergenic
1044726733 8:95200513-95200535 CTGCTTTCCCACAAGTAAGTTGG - Intergenic
1044791052 8:95847367-95847389 ATGCTTTACCTCTAGCACAATGG + Intergenic
1045005127 8:97910804-97910826 CAGTTTTCCCTCTAGTAAAATGG + Intronic
1047722984 8:127659423-127659445 CTGATTTCCCTGAAGGAAGAAGG - Intergenic
1048490792 8:134891759-134891781 CTGTTTTCCTTTAAGTAAAAAGG - Intergenic
1048664692 8:136647827-136647849 CTGTTTTTCCTCACACAAAAAGG - Intergenic
1049133772 8:140874641-140874663 TGGCTTTCTCACAAGCAAAATGG + Intronic
1050618652 9:7429623-7429645 GTTCTTTCCCTCAAGGAAAGAGG + Intergenic
1051874890 9:21781829-21781851 TTGCTTTCACTCAAGAACAAAGG + Intergenic
1052355707 9:27502987-27503009 CCTCTTTCCCCCAAGAAAAAGGG - Intronic
1053218150 9:36289804-36289826 CTGACCTCCCCCAAGCAAAAGGG + Intronic
1055152473 9:73019355-73019377 CTGCTTTCACTCATAGAAAAAGG + Intronic
1056082475 9:83110316-83110338 CTGCTTGACCTCAAGCCAATTGG - Intergenic
1057481466 9:95448321-95448343 CTGCTGTCCCTCCAGGAAATGGG - Intronic
1058323848 9:103670548-103670570 CTGCTTTCACTTATACAAAATGG - Intergenic
1058684360 9:107467117-107467139 CTGCATTCCCTGAAGCCAAGGGG - Intergenic
1059260450 9:112971049-112971071 CTGCTTTCCCAGAAGAAAAATGG - Intergenic
1059283290 9:113152370-113152392 CATCTTTTCCTCTAGCAAAAAGG + Intronic
1060960301 9:127676075-127676097 CTGCATTTCCCCAAACAAAAAGG - Intronic
1186706257 X:12142086-12142108 CTTCTTTTCTTTAAGCAAAACGG + Intronic
1187103251 X:16216552-16216574 CTGCTTTCACTCAAGGCAGAAGG + Intergenic
1187208433 X:17205184-17205206 ATTCTTTCCCTGAAGCAAAGAGG - Intergenic
1187797931 X:23024734-23024756 CTGACCTCCCTCAAGCAAGAAGG + Intergenic
1188593653 X:31870108-31870130 CTGGTTTCCCTTGAACAAAATGG + Intronic
1189491068 X:41472223-41472245 TGGCTTAGCCTCAAGCAAAAAGG + Intronic
1189672937 X:43431079-43431101 CTTTTTTCCCTCTAGCTAAACGG - Intergenic
1192018288 X:67356234-67356256 CTGCTTTCCGTCAATCAATTTGG + Intergenic
1193337429 X:80307058-80307080 CTTCTTCTCCTCAAGCAAAACGG + Intergenic
1193381037 X:80816074-80816096 CTGTTTTCTCTCCAGCAAACTGG - Intergenic
1194900704 X:99507425-99507447 CTGCATTCCCACAAGTAAAATGG + Intergenic
1198741341 X:139846559-139846581 CTGCTTTCCCTATAGCAACTGGG - Intronic