ID: 1027359656

View in Genome Browser
Species Human (GRCh38)
Location 7:77394805-77394827
Sequence CTGCCTACACATGTACAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027359656_1027359664 27 Left 1027359656 7:77394805-77394827 CCAAGCTGTACATGTGTAGGCAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1027359664 7:77394855-77394877 CAGAAAGCAAGACACAGGTAGGG No data
1027359656_1027359662 22 Left 1027359656 7:77394805-77394827 CCAAGCTGTACATGTGTAGGCAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1027359662 7:77394850-77394872 CTTGGCAGAAAGCAAGACACAGG No data
1027359656_1027359663 26 Left 1027359656 7:77394805-77394827 CCAAGCTGTACATGTGTAGGCAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1027359663 7:77394854-77394876 GCAGAAAGCAAGACACAGGTAGG 0: 1
1: 0
2: 2
3: 30
4: 390
1027359656_1027359657 4 Left 1027359656 7:77394805-77394827 CCAAGCTGTACATGTGTAGGCAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1027359657 7:77394832-77394854 TAGATTTTCCCAAGTGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027359656 Original CRISPR CTGCCTACACATGTACAGCT TGG (reversed) Intronic
900652277 1:3735489-3735511 CTCCCTAGACAGGTGCAGCTGGG - Exonic
903609072 1:24596917-24596939 CTGGCTACACATATACCCCTGGG + Intronic
905002467 1:34683729-34683751 CTGGCCACAGGTGTACAGCTGGG - Intergenic
910147441 1:84098714-84098736 GTGCCTGCACTTGTGCAGCTGGG - Intronic
913060702 1:115204105-115204127 CACTCTACACATGTGCAGCTTGG - Intergenic
914997466 1:152557608-152557630 CTGACTCCACAGGCACAGCTAGG + Intronic
917460183 1:175222687-175222709 CTCCCTCCACATGTGCAGTTAGG - Intergenic
919349293 1:196428859-196428881 CTGCCCACACATGGGCAGCCAGG + Intronic
923333724 1:232949310-232949332 CTGCCCACACATGGACCTCTTGG - Intergenic
1063273834 10:4541714-4541736 CTGGCTACAGATGCCCAGCTGGG - Intergenic
1067517348 10:46962929-46962951 CTCTCTACACATTTACATCTTGG - Intronic
1067644900 10:48088900-48088922 CTCTCTACACATTTACATCTTGG + Intergenic
1069613762 10:69793043-69793065 CTGCCTTCACAGCTACTGCTGGG + Intergenic
1070355813 10:75639334-75639356 CTGCTTACACTTGTAAAGCCAGG - Intronic
1072416306 10:95249481-95249503 CTGCCTGCATCTGTAAAGCTGGG - Intronic
1076159996 10:128236407-128236429 CTGCATGCACAGGCACAGCTGGG - Intergenic
1079009168 11:16814402-16814424 CTGCCTACCTCTGTACAGCCTGG + Intronic
1081716362 11:45253194-45253216 CTGCCCAGAAATGTACACCTTGG + Intronic
1083924016 11:65795166-65795188 CTCCTCACACACGTACAGCTTGG - Exonic
1084164646 11:67369862-67369884 CTCCCTACACAGGGACAGCAGGG + Intronic
1084303411 11:68265898-68265920 CTGCCTACAGCTATGCAGCTGGG - Intronic
1085293761 11:75418805-75418827 CAGCCTGCCCAGGTACAGCTGGG + Intronic
1085320968 11:75573689-75573711 CTGCAGACCCATGTACATCTTGG - Intergenic
1086462420 11:87018957-87018979 CTGCCACCACAGGGACAGCTAGG - Intergenic
1088863997 11:113828898-113828920 CTCCCTACTCAGGTACAGGTAGG + Intronic
1089095258 11:115914930-115914952 CTGCCTACAAGTCTACATCTTGG - Intergenic
1089260201 11:117219039-117219061 CTGCCAACACCTGTTCACCTTGG + Exonic
1090575405 11:128096732-128096754 CTGCCTTCACCAGTACAGGTGGG + Intergenic
1090959777 11:131545957-131545979 CTGACTACCCATAAACAGCTGGG - Intronic
1091404610 12:201486-201508 CTGCCCACACATGTCCAGTGGGG - Intronic
1102968089 12:117144095-117144117 CTAGATACATATGTACAGCTGGG + Intronic
1103501892 12:121409477-121409499 CTGCCTACACTGTTTCAGCTGGG - Intronic
1104069308 12:125330786-125330808 CTGCCTCCCCAAGTGCAGCTTGG - Intronic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1113060061 13:106313440-106313462 CTGCATACACATATATACCTAGG - Intergenic
1115157351 14:30356317-30356339 CTACCCAGACATGAACAGCTGGG + Intergenic
1115499390 14:34035875-34035897 CTGTCTGTACATGTCCAGCTTGG - Intronic
1117496723 14:56312823-56312845 GTGCCTACCTCTGTACAGCTTGG + Intergenic
1122915485 14:104856415-104856437 CTGCCTAGGCTTGCACAGCTGGG - Intergenic
1124631177 15:31338572-31338594 CTGCCTACACAGCCACGGCTGGG - Intronic
1124951720 15:34328855-34328877 CTGCCTACCCAAGTCCAGCCTGG + Intronic
1132132581 15:99296592-99296614 CTGACCACACATATACAGCCTGG - Intronic
1133406142 16:5526060-5526082 CTGTCTACACATGCACTGCCTGG - Intergenic
1137730139 16:50683619-50683641 CTGCCAGCACTTGTACAGCTCGG - Intergenic
1137953412 16:52805541-52805563 CTGCCTACACCAGGAAAGCTAGG + Intergenic
1139160295 16:64497953-64497975 CTGCCTACTCTTGTGCATCTTGG - Intergenic
1143460687 17:7101616-7101638 CTGCCTGCAGGTGTACCGCTGGG - Exonic
1147034957 17:37672934-37672956 CTGCCCACACATACACTGCTAGG - Intergenic
1152534812 17:80944433-80944455 ATGCTTCCACATGTCCAGCTCGG + Intronic
1156449734 18:37260128-37260150 CTGCCAAAACACGCACAGCTGGG + Intronic
1165130872 19:33631149-33631171 CTGCCCACACAGGTTGAGCTGGG + Intronic
928725607 2:34170608-34170630 CTCCCTACAGATGTCCAGCCTGG - Intergenic
938390785 2:130903574-130903596 CAACCTGTACATGTACAGCTTGG - Intronic
939056126 2:137366449-137366471 CTGAATACACATGTAAAGCAAGG - Intronic
943499481 2:188669200-188669222 ATACCTACACATGTTCAACTTGG + Intergenic
1168967642 20:1908598-1908620 CTGCACACACATGTACACATGGG - Intronic
1170827201 20:19806983-19807005 CTTCCTGCACAGGTTCAGCTAGG + Intergenic
1172512756 20:35511985-35512007 CTGTCTCCACTTGTGCAGCTGGG + Exonic
1173334434 20:42101392-42101414 CTGCAAACACCTGTACACCTTGG + Intronic
1179708710 21:43197577-43197599 CCACCTACGCATGTACAGATTGG - Intergenic
1181429043 22:22866517-22866539 CTGCCAACTCATGAGCAGCTAGG - Intronic
1183808518 22:40233897-40233919 TTGCCTGCACATGCACAGATTGG + Intronic
953979521 3:47406698-47406720 CTGCTTTCCCATGTGCAGCTGGG - Exonic
954330803 3:49889237-49889259 CTGCCTACCCATATCCAGATTGG - Intronic
955046807 3:55368514-55368536 CTGACTAGGCATCTACAGCTGGG + Intergenic
955349639 3:58184098-58184120 ATGCCTACCCATGCACAGCAAGG - Intergenic
955597111 3:60603441-60603463 CTTAATACACATGTACAGATAGG - Intronic
957190435 3:77001520-77001542 CTGCCAACACATGAACAGGGGGG + Intronic
962714835 3:138116871-138116893 CTGCCTCAAAATGTAGAGCTTGG - Intergenic
963963353 3:151335386-151335408 CTGCCTATTTTTGTACAGCTTGG - Intronic
970504920 4:16718525-16718547 ATGACTACACATATACAGGTTGG - Intronic
972374284 4:38456287-38456309 CTGCCTGCACCTGCACAGCCTGG - Intergenic
972516983 4:39818236-39818258 CTCTCTACACATACACAGCTTGG - Intergenic
973902618 4:55493116-55493138 TTGCCTCCTCATGTATAGCTAGG - Intronic
975687267 4:76929748-76929770 CTGCCTCCCCAAGTGCAGCTTGG - Intergenic
977403764 4:96569586-96569608 ATGCCCAAACATGGACAGCTGGG + Intergenic
982244560 4:153337911-153337933 CTGCCTCCCCATGTCCAGCAAGG - Exonic
983408436 4:167363674-167363696 CTTCCTTTACATGTACATCTTGG + Intergenic
985632545 5:1021551-1021573 ATTCCGACACATGTGCAGCTGGG - Intronic
993391794 5:87327246-87327268 CTGCCTACATTTGCGCAGCTAGG + Intronic
996676703 5:126183511-126183533 CTGCCTGCGCATACACAGCTGGG + Intergenic
1001414200 5:171532702-171532724 CAACCTGCACATGTACACCTTGG - Intergenic
1003013766 6:2451540-2451562 CTGCCTGGAGCTGTACAGCTGGG - Intergenic
1010169374 6:72957147-72957169 CTTCCTACATATGTACAGCCAGG - Intronic
1015841935 6:137486623-137486645 CTGTCCCCAAATGTACAGCTGGG - Intergenic
1015842426 6:137489286-137489308 CTGCCTACACGTGAAGAGCTTGG + Intergenic
1019008177 6:168821057-168821079 ATGCCCACAAATGTAGAGCTGGG + Intergenic
1019262487 7:89181-89203 GTGTCTGCACATGTACATCTGGG + Intergenic
1019423451 7:962463-962485 CCGCCTCCACATACACAGCTGGG + Intronic
1019784484 7:2966589-2966611 CTGCCTACACACTGAAAGCTGGG - Intronic
1023055348 7:36285941-36285963 CTGTCTGCACATGTACACCTGGG + Intronic
1024098351 7:46004395-46004417 CTGACTCCACATGTACCCCTAGG - Intergenic
1027359656 7:77394805-77394827 CTGCCTACACATGTACAGCTTGG - Intronic
1027662743 7:81006532-81006554 CTGGCTACACAGGTCCAACTCGG + Intergenic
1029734437 7:102457715-102457737 CTCCCGACACATGGACAGCACGG + Exonic
1030988596 7:116272171-116272193 CTGCCAACAAATGAAGAGCTTGG - Intergenic
1035104750 7:156432832-156432854 CGGCCTACAAATGTACCGTTAGG - Intergenic
1036435215 8:8726606-8726628 CACCCTATACATGTACAGCTTGG + Intergenic
1036594222 8:10197691-10197713 CTGCCTACACATGCCCACCTGGG + Intronic
1040493065 8:47942560-47942582 CTGTTTACCCATGTACAGCAGGG + Intronic
1053219327 9:36298808-36298830 CTGCCTACATCTGGACACCTAGG + Intronic
1054752549 9:68922535-68922557 ATGTCTACAAGTGTACAGCTTGG + Intronic
1057263836 9:93601239-93601261 CTGTCTGCACATATACAGCCAGG + Intronic
1058384637 9:104419727-104419749 CTGACTACACGTGTATTGCTGGG - Intergenic
1186033041 X:5390923-5390945 CTTCCTGCCCATGTTCAGCTGGG + Intergenic
1187267239 X:17746802-17746824 CTGCCTCCCCATGCACTGCTAGG + Intronic
1193077720 X:77373275-77373297 CTGTCGACACATGTACAGGCAGG + Intergenic
1200066573 X:153506911-153506933 CTGGCCTCACCTGTACAGCTTGG - Exonic