ID: 1027361910

View in Genome Browser
Species Human (GRCh38)
Location 7:77417489-77417511
Sequence GTGAATAAAAGGAAGGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027361907_1027361910 2 Left 1027361907 7:77417464-77417486 CCTAATGAAGCTGCTAATATTAT No data
Right 1027361910 7:77417489-77417511 GTGAATAAAAGGAAGGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027361910 Original CRISPR GTGAATAAAAGGAAGGCCAC TGG Intergenic
No off target data available for this crispr