ID: 1027363836

View in Genome Browser
Species Human (GRCh38)
Location 7:77436077-77436099
Sequence CACTTCAAACCAGGAGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027363832_1027363836 8 Left 1027363832 7:77436046-77436068 CCAGCTACTTGGGAGGCTGAGGC 0: 81212
1: 190903
2: 234468
3: 228974
4: 272812
Right 1027363836 7:77436077-77436099 CACTTCAAACCAGGAGACGGAGG No data
1027363830_1027363836 9 Left 1027363830 7:77436045-77436067 CCCAGCTACTTGGGAGGCTGAGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975
Right 1027363836 7:77436077-77436099 CACTTCAAACCAGGAGACGGAGG No data
1027363828_1027363836 16 Left 1027363828 7:77436038-77436060 CCGGAGTCCCAGCTACTTGGGAG 0: 23
1: 871
2: 3149
3: 5019
4: 6192
Right 1027363836 7:77436077-77436099 CACTTCAAACCAGGAGACGGAGG No data
1027363827_1027363836 17 Left 1027363827 7:77436037-77436059 CCCGGAGTCCCAGCTACTTGGGA 0: 182
1: 43757
2: 157840
3: 222557
4: 227684
Right 1027363836 7:77436077-77436099 CACTTCAAACCAGGAGACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027363836 Original CRISPR CACTTCAAACCAGGAGACGG AGG Intergenic
No off target data available for this crispr