ID: 1027364397

View in Genome Browser
Species Human (GRCh38)
Location 7:77442384-77442406
Sequence CCTTATTAGTTGTTATTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027364397_1027364400 19 Left 1027364397 7:77442384-77442406 CCTGAAAATAACAACTAATAAGG No data
Right 1027364400 7:77442426-77442448 TCTGACACTCAATAGTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027364397 Original CRISPR CCTTATTAGTTGTTATTTTC AGG (reversed) Intergenic
No off target data available for this crispr