ID: 1027371832

View in Genome Browser
Species Human (GRCh38)
Location 7:77514320-77514342
Sequence ATGTGGTTGGGGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027371832_1027371842 17 Left 1027371832 7:77514320-77514342 CCTTCTTCCCTCCCCAACCACAT No data
Right 1027371842 7:77514360-77514382 TAATGGTCAAAAGTTGGAGCTGG No data
1027371832_1027371841 11 Left 1027371832 7:77514320-77514342 CCTTCTTCCCTCCCCAACCACAT No data
Right 1027371841 7:77514354-77514376 GCATGCTAATGGTCAAAAGTTGG No data
1027371832_1027371840 0 Left 1027371832 7:77514320-77514342 CCTTCTTCCCTCCCCAACCACAT No data
Right 1027371840 7:77514343-77514365 GGAAAGAACTTGCATGCTAATGG No data
1027371832_1027371843 18 Left 1027371832 7:77514320-77514342 CCTTCTTCCCTCCCCAACCACAT No data
Right 1027371843 7:77514361-77514383 AATGGTCAAAAGTTGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027371832 Original CRISPR ATGTGGTTGGGGAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr