ID: 1027372383

View in Genome Browser
Species Human (GRCh38)
Location 7:77519743-77519765
Sequence CAGAGGTACAATTTTAAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027372374_1027372383 23 Left 1027372374 7:77519697-77519719 CCTAAGAAAAATAAGACAGGGAA No data
Right 1027372383 7:77519743-77519765 CAGAGGTACAATTTTAAATTGGG No data
1027372371_1027372383 25 Left 1027372371 7:77519695-77519717 CCCCTAAGAAAAATAAGACAGGG No data
Right 1027372383 7:77519743-77519765 CAGAGGTACAATTTTAAATTGGG No data
1027372373_1027372383 24 Left 1027372373 7:77519696-77519718 CCCTAAGAAAAATAAGACAGGGA No data
Right 1027372383 7:77519743-77519765 CAGAGGTACAATTTTAAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027372383 Original CRISPR CAGAGGTACAATTTTAAATT GGG Intergenic
No off target data available for this crispr