ID: 1027380276

View in Genome Browser
Species Human (GRCh38)
Location 7:77600981-77601003
Sequence GTATTGTTGCATTAAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027380273_1027380276 22 Left 1027380273 7:77600936-77600958 CCTTGTAAGTTGATGTGGTCTCA 0: 1
1: 1
2: 0
3: 15
4: 145
Right 1027380276 7:77600981-77601003 GTATTGTTGCATTAAAACACAGG 0: 1
1: 0
2: 0
3: 15
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027380276 Original CRISPR GTATTGTTGCATTAAAACAC AGG Intronic
902753471 1:18533747-18533769 CTATTGTTGCTTTAAACCACTGG + Intergenic
907932943 1:59017041-59017063 ATATTGTTGCATAAACACATCGG + Intergenic
908079656 1:60562464-60562486 GTGTTGTTGAATTAAAAGAAAGG + Intergenic
908615558 1:65917857-65917879 ATATTTTTACTTTAAAACACTGG + Intronic
909688854 1:78382286-78382308 GCATGGTTGCATAAATACACAGG - Intronic
911012381 1:93294687-93294709 CTATTGTTGGATTAAATAACAGG + Intergenic
915578891 1:156801523-156801545 GTACTGTTGCAGGAAAACACTGG + Intergenic
917426156 1:174916534-174916556 GTTTTTTTGTATTAAAATACAGG + Intronic
917567462 1:176227706-176227728 TTATTGTAGGATTAAAACAGAGG + Intergenic
923828653 1:237528638-237528660 GTATTGATGGCATAAAACACTGG + Intronic
1063833906 10:9989737-9989759 GTATTAATGAATTATAACACAGG + Intergenic
1064698026 10:17987863-17987885 GTATTTTTGAAATAAAACAAAGG + Intronic
1067512472 10:46907348-46907370 GTATTCTTGCTGTAAAGCACAGG + Intergenic
1067649772 10:48144474-48144496 GTATTCTTGCTGTAAAGCACAGG - Intergenic
1068062052 10:52080359-52080381 GTTTTGTTGGATTCAAAGACGGG - Intronic
1068624606 10:59228166-59228188 GTCTTATTGCAGGAAAACACTGG + Intronic
1071782546 10:88862721-88862743 GTCCTGTTGCATTACAACACTGG + Intergenic
1072444110 10:95483187-95483209 TCTTTGTTTCATTAAAACACTGG + Intronic
1073689976 10:105797810-105797832 TTATGGTTACATTAAAACACGGG + Intergenic
1074707092 10:116142966-116142988 GAATAGTTGCAGTAAAGCACAGG + Intronic
1078826443 11:14935046-14935068 TTATTGTTGAATTAAACCACAGG + Intronic
1079087224 11:17455037-17455059 GTGTTGTTGCTTTAAAATAGTGG - Intronic
1084839538 11:71833811-71833833 GTAATGTAGAATTTAAACACAGG + Intronic
1087287301 11:96278731-96278753 GTATTGCTGAATTAAACTACTGG - Intronic
1087315784 11:96600545-96600567 GTTTTGTTTCATTTAAAGACAGG - Intergenic
1088021725 11:105128020-105128042 GCATTCTTTCATTAACACACAGG + Intergenic
1089336945 11:117731671-117731693 GTATTGTGGTATTAAACGACAGG - Intronic
1090568908 11:128026094-128026116 GTATTGTTGGATCAACACATGGG - Intergenic
1093605311 12:21081844-21081866 ATATTGTTACATTAAAAAAAAGG + Intronic
1094135526 12:27121270-27121292 TGATTTTTGCATGAAAACACAGG - Intergenic
1096683738 12:53274158-53274180 GTATTCTTGCTTAAGAACACTGG - Intronic
1101517872 12:105453571-105453593 GTATTTTTGTTTTAAAACAAGGG - Intergenic
1103610085 12:122118360-122118382 GTATTGTTGAAATATAACACTGG - Intronic
1104652179 12:130543461-130543483 GTATTGCTGCAGAAAAACTCAGG + Intronic
1107081770 13:36382642-36382664 GTTATGTTCTATTAAAACACTGG + Intergenic
1107273423 13:38648079-38648101 GTTGTGTTGATTTAAAACACAGG - Intergenic
1108069779 13:46616572-46616594 ATAGTGTTGTATTAAAAAACAGG + Intronic
1108235737 13:48403133-48403155 GTGTTTTTACATCAAAACACAGG - Intronic
1109533116 13:63679173-63679195 GAATTATAGCATTAAAATACAGG + Intergenic
1109734174 13:66459307-66459329 GCATTATTGCATTAAATGACAGG - Intronic
1110053238 13:70931894-70931916 TTATTGCTGCAATACAACACAGG + Intergenic
1110515657 13:76409310-76409332 TTATTGCTGCTTTAAAAGACCGG - Intergenic
1111350104 13:87017089-87017111 TTATTATGACATTAAAACACTGG - Intergenic
1113067087 13:106383582-106383604 TTATTGTTGCAGAAACACACTGG + Intergenic
1120320137 14:82949223-82949245 GCATTGTTGCTTTGAGACACAGG + Intergenic
1122327657 14:100892034-100892056 GTATTATTTCATTTAAACAGAGG + Intergenic
1126511643 15:49482251-49482273 TTAGTGTGTCATTAAAACACAGG + Intronic
1132075508 15:98816644-98816666 TTAAGGTTACATTAAAACACAGG - Intronic
1137847145 16:51701865-51701887 GTTTTGTTGCATGAAGACAGTGG + Intergenic
1138470447 16:57230524-57230546 TTATTGTTACATTAAAATATTGG + Intronic
1138937394 16:61745651-61745673 ATATTGTTACTTTAACACACCGG + Intronic
1145046592 17:19622429-19622451 GTATTGTTATATGAAAACACTGG + Intergenic
1150751645 17:67869173-67869195 CTGTTGTTGTACTAAAACACAGG - Intronic
1152472363 17:80497093-80497115 GTTTTGCTGCAGTAACACACAGG - Intergenic
1156441307 18:37191009-37191031 GTAATGGTCCATTAAAACTCTGG + Intronic
1156835344 18:41546758-41546780 ATTTTATTGTATTAAAACACAGG - Intergenic
1157774292 18:50379601-50379623 GTTTTGGGGCTTTAAAACACAGG - Intronic
1159233790 18:65644555-65644577 TTCATGTTGGATTAAAACACTGG + Intergenic
1160238475 18:77104751-77104773 GTATTTTTGCATCAGAACAAAGG + Intronic
926035531 2:9632478-9632500 GCATTTCTGCATTAAGACACAGG - Intergenic
927825699 2:26308759-26308781 GTATTGTTGTAGTTAAAAACTGG + Intronic
928604340 2:32931426-32931448 ATATAGTTTTATTAAAACACAGG + Intergenic
930404471 2:50938028-50938050 GTATTTGTGCATTTAAACATAGG + Intronic
930551573 2:52841195-52841217 TTATGGCTGCATTAAAACAGAGG + Intergenic
931360526 2:61574187-61574209 GTAATCTTGCATTTAAACATTGG - Intergenic
935021544 2:99237267-99237289 ATATTGATGGATTAAAACAAAGG + Intronic
938656528 2:133440387-133440409 CTGTTGTTGAATGAAAACACTGG + Intronic
939901760 2:147859125-147859147 GTATTGCTAGACTAAAACACTGG - Intronic
944415340 2:199474422-199474444 GTACTGTTGCTTTCAAACACAGG + Intergenic
947066967 2:226238141-226238163 ATATTGTTTCATTAAATCATAGG - Intergenic
1169305242 20:4483869-4483891 GTTTTGTTTCATTAAAACTGGGG + Intergenic
1171206824 20:23288026-23288048 GTTTTGTTGGATCAAAAGACCGG + Intergenic
1171798577 20:29585779-29585801 AAATTGTTGAATTAAAACAAAGG - Intergenic
1171845516 20:30271394-30271416 AAATTGTTGAATTAAAACAAAGG + Intergenic
1176793463 21:13348367-13348389 TTAGTGTGTCATTAAAACACAGG + Intergenic
950942941 3:16912152-16912174 TAATGGTTGCATTAAACCACTGG - Intronic
951206704 3:19933470-19933492 GTTGGGTTTCATTAAAACACAGG + Exonic
952430834 3:33221063-33221085 GTATGGTTGCTTTAGAAAACCGG + Intergenic
953746987 3:45582790-45582812 GTTTTGTTTTTTTAAAACACAGG - Intronic
954102268 3:48383119-48383141 GTATTTTTGCCTCAAAACACTGG - Intronic
954977673 3:54711958-54711980 TATTTCTTGCATTAAAACACAGG - Intronic
956424700 3:69121812-69121834 GTATCGTGGCAATAGAACACAGG + Intronic
957493582 3:80961763-80961785 AAGTTGTTGAATTAAAACACAGG + Intergenic
958592247 3:96172878-96172900 GTAATGTTTCATTAAAAAATTGG + Intergenic
958879499 3:99653753-99653775 TTATTGATGCATCAAAATACAGG - Intronic
958939596 3:100296239-100296261 GTATTATTGCAGCAAAACACCGG + Exonic
959268100 3:104169046-104169068 GTAATGTTTCATTGGAACACAGG + Intergenic
960071622 3:113437610-113437632 GTATTGCTACATCAGAACACCGG - Intronic
963806645 3:149729240-149729262 ATATTGTTGAATTATAACATTGG - Intronic
967641713 3:191873406-191873428 ATATTGATGCATTTAAATACTGG + Intergenic
968538980 4:1152953-1152975 TTTTTTTTGCATTAAAACCCGGG + Intergenic
969780625 4:9399815-9399837 GTAATGTAGAATTTAAACACAGG + Intergenic
970634514 4:17992879-17992901 GTCTTTTTGCATTTAAACCCAGG - Intronic
972104822 4:35470072-35470094 GTATTTTTGGATTAAAAAAAAGG + Intergenic
973062875 4:45751033-45751055 TTATAGTTGCATTATAAAACGGG + Intergenic
973108902 4:46376578-46376600 GTATTAGTTCATTAAAACATGGG + Intronic
975383559 4:73729546-73729568 CTGTTGTTGGATTTAAACACTGG - Intergenic
975516778 4:75256898-75256920 GTTATGCTGTATTAAAACACTGG + Intergenic
976460631 4:85307956-85307978 ATTTTGGTGCATTTAAACACTGG - Intergenic
977909669 4:102518576-102518598 CTTTTGTTGCATTAAAAAAAAGG + Intronic
978272406 4:106906838-106906860 GCATTAGTGCATTAATACACAGG - Intergenic
979783458 4:124685319-124685341 GTTTTGTTACTTTAAAACAAAGG + Intronic
980586196 4:134818549-134818571 TATTTGTTGCAATAAAACACTGG + Intergenic
981790322 4:148528912-148528934 GTATTGTTGCAAGAAAACTTTGG + Intergenic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
982941929 4:161570050-161570072 GTATTGTTACAAAAAAACAAGGG - Intronic
983188761 4:164731748-164731770 TTATTGTTGAACTAAAACAGAGG + Intergenic
984455134 4:179957038-179957060 GCATTGTTGAAATAACACACTGG + Intergenic
984591391 4:181621440-181621462 GTATTATAGCATTAAAATATGGG - Intergenic
987892236 5:23894172-23894194 AAACTGTTGAATTAAAACACTGG - Intergenic
989136598 5:38162054-38162076 GTGTTGTTGAATGAAAACAAAGG - Intergenic
989558358 5:42823092-42823114 TTATTGTTGCAGTTAAACTCTGG - Intronic
990511806 5:56496073-56496095 ATATTGTTGCATTGAAAGAAAGG + Intergenic
990920295 5:60957361-60957383 TTATTGTTACATTTAAAAACAGG - Intronic
990964987 5:61436275-61436297 GTATTGTTCAGTTAAAGCACAGG - Intronic
991984623 5:72272053-72272075 GGATGGTTGCAATGAAACACTGG + Intronic
996049619 5:118917433-118917455 GTATTCTTGCATTTGAACATAGG - Intronic
997703610 5:135925667-135925689 TTTTTTTTGCATTAAATCACAGG + Intronic
998730562 5:145070930-145070952 ACATTGTTGGATTAGAACACAGG - Intergenic
1000669812 5:164047031-164047053 GTATTGTTGCATTTACAGAAAGG - Intergenic
1001121613 5:168985526-168985548 GGGCTGTTGCAGTAAAACACAGG - Intronic
1005423873 6:25680790-25680812 GTATTACAGAATTAAAACACAGG - Intronic
1007391834 6:41553813-41553835 GAACTGATCCATTAAAACACAGG + Intronic
1008838449 6:55867377-55867399 GTTTTGTTGCAGCAAAACAAGGG - Intronic
1015436142 6:133191348-133191370 GGATTGTTAAATTTAAACACTGG + Intergenic
1018322184 6:162623017-162623039 ATATGGTAGCATTAAAACAATGG - Intronic
1020379168 7:7523553-7523575 GTATTGTTGCATAAAATAATAGG - Intronic
1021090377 7:16475683-16475705 CTATGGTTTCATTAAAACACAGG - Intronic
1021943022 7:25698270-25698292 GTATGGTTGTATCACAACACAGG - Intergenic
1025761118 7:64393569-64393591 ATCTTGTTGAATCAAAACACAGG + Intergenic
1026531814 7:71205747-71205769 ATATTATTGCATCAAAACACAGG + Intronic
1027380276 7:77600981-77601003 GTATTGTTGCATTAAAACACAGG + Intronic
1027490099 7:78813011-78813033 GTATAGCTGCATTCAAAGACAGG - Intronic
1027551448 7:79602017-79602039 GTTTAGTTGCATTCAAACATAGG + Intergenic
1028885777 7:95931046-95931068 GTATTGCTGCATTAAATGTCAGG + Intronic
1030842013 7:114366403-114366425 GTATTGTAACATAAAAACAAAGG - Intronic
1031086973 7:117311881-117311903 GTATTGTAAGATTAAAACAAAGG + Intronic
1031448761 7:121887812-121887834 TTTTTGTTTCATTAAAACCCCGG - Intronic
1033421984 7:141211717-141211739 GGATTTATGCATTAATACACTGG + Intronic
1033437901 7:141350834-141350856 GTATTGCTGCTTTGAATCACGGG - Intronic
1036278060 8:7373748-7373770 GTAATGTAGAATTTAAACACAGG + Intronic
1036343463 8:7938144-7938166 GTAATGTAGAATTTAAACACAGG - Intronic
1036838804 8:12098908-12098930 GTCTTGTAGAATTTAAACACAGG - Intergenic
1036860592 8:12345151-12345173 GTCTTGTAGAATTTAAACACAGG - Intergenic
1037023621 8:14004977-14004999 GTATTGCTTTATTAAGACACTGG - Intergenic
1038259950 8:25984232-25984254 ATATTGTTTCAGTAAAACAGTGG - Intronic
1038464496 8:27748717-27748739 GTATTGGTGGTTTAAAACAAGGG - Intronic
1038606486 8:29011210-29011232 AAATTTTTGCAATAAAACACTGG + Intronic
1038770610 8:30475845-30475867 TTATTGTTGCATTAAAGCGATGG - Intronic
1038812956 8:30869976-30869998 GTATTGCTGCAGAAAAACATGGG - Intronic
1042774702 8:72417668-72417690 GTATTGTGAGCTTAAAACACAGG - Intergenic
1045014873 8:97992410-97992432 ATAATGTAGCTTTAAAACACTGG - Intronic
1045181096 8:99783517-99783539 TTGCTGTTACATTAAAACACTGG - Intronic
1046349542 8:112989378-112989400 GTATTGTTTCATAGAAACATAGG - Intronic
1048605567 8:135964766-135964788 TTATTTGTGCATTAAAACATGGG + Intergenic
1050170551 9:2811338-2811360 GTAATGTGCCATTAAAGCACAGG - Intronic
1050843406 9:10183173-10183195 GTATTGTTTCTTTAAAAAAATGG - Intronic
1052377274 9:27731665-27731687 ATATTCCTGCATGAAAACACAGG + Intergenic
1053621163 9:39819803-39819825 TTATTGTGTCATTAAAACACAGG - Intergenic
1053883927 9:42624529-42624551 TTAGTGTGTCATTAAAACACAGG + Intergenic
1053888741 9:42669765-42669787 TTAGTGTGTCATTAAAACACAGG - Intergenic
1054222947 9:62431975-62431997 TTAGTGTGTCATTAAAACACAGG + Intergenic
1054227763 9:62477212-62477234 TTAGTGTGTCATTAAAACACAGG - Intergenic
1054262998 9:62887634-62887656 TTATTGTGTCATTAAAACACAGG + Intergenic
1056024727 9:82481949-82481971 ATATTGTTTCATAAAATCACAGG - Intergenic
1059153701 9:111971217-111971239 GTATTGGTGCAGCTAAACACAGG + Intergenic
1061804728 9:133131563-133131585 GTGTTGCTGCATTAAGACAGGGG - Intronic
1188335701 X:28929857-28929879 ATTTTGTTGCATTAACACACAGG - Intronic
1188485782 X:30680472-30680494 GTAGTGTAGACTTAAAACACGGG + Intronic
1189746282 X:44171990-44172012 GTATTGTTGGGTGAAATCACAGG + Intronic
1191755159 X:64584914-64584936 GTGTTCTTACATGAAAACACAGG - Intergenic
1191784357 X:64901758-64901780 GTATTGTTGCCTTAATACTTTGG + Intergenic
1194808494 X:98360477-98360499 TTAGTGTTTCATTAAAAAACTGG - Intergenic
1198569348 X:137938612-137938634 GTAATGTGGAATTAAAACAAAGG - Intergenic
1198818900 X:140624415-140624437 GTATTATTGCATTCTCACACTGG + Intergenic
1199446098 X:147923771-147923793 GTATGTTTGCAATACAACACTGG + Intronic