ID: 1027381110

View in Genome Browser
Species Human (GRCh38)
Location 7:77610394-77610416
Sequence ATTCAATGTATAATCTATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 256}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027381110_1027381113 15 Left 1027381110 7:77610394-77610416 CCCACATAGATTATACATTGAAT 0: 1
1: 0
2: 1
3: 19
4: 256
Right 1027381113 7:77610432-77610454 ATATTTCCTTCACTTTTTATGGG No data
1027381110_1027381112 14 Left 1027381110 7:77610394-77610416 CCCACATAGATTATACATTGAAT 0: 1
1: 0
2: 1
3: 19
4: 256
Right 1027381112 7:77610431-77610453 TATATTTCCTTCACTTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027381110 Original CRISPR ATTCAATGTATAATCTATGT GGG (reversed) Intronic
903407325 1:23108765-23108787 ATTGAATATTTACTCTATGTCGG - Intronic
904972681 1:34431531-34431553 ATTCAATGAATACTCACTGTGGG + Intergenic
905544897 1:38789990-38790012 ACTCAATCCAAAATCTATGTGGG - Intergenic
909037037 1:70605186-70605208 ATTTAATTTTTAATTTATGTGGG + Intergenic
909656497 1:78039401-78039423 ATTCAATGTTGAGTCTAGGTAGG + Intronic
909843283 1:80356898-80356920 ATTCAATAGCTAGTCTATGTAGG + Intergenic
910552317 1:88489565-88489587 ATTCAATGTGTAATCTAGTCAGG - Intergenic
911712532 1:101091228-101091250 ATGGAATTTATAATCTATTTAGG - Intergenic
911952446 1:104192314-104192336 ATTGGATGTATCATCTATATTGG - Intergenic
913226162 1:116701216-116701238 ATTCATTATTTAATCTATCTAGG + Intronic
915887649 1:159740403-159740425 ATGCAATGTGTGATCTATATTGG + Intergenic
916414427 1:164579235-164579257 ATTGAATATATAATAAATGTAGG - Intronic
916642365 1:166744205-166744227 ATTCATTCAATAATGTATGTAGG + Intergenic
919276958 1:195431796-195431818 ATTGAATATAAAATCAATGTAGG - Intergenic
924171413 1:241345603-241345625 ATTCAATGTATCTTTTAAGTAGG - Intronic
924694022 1:246381657-246381679 ATTCACTGTATAAAATATGCAGG - Intronic
1062924091 10:1301413-1301435 CTTCCATTTATAATCTATTTAGG - Intronic
1063428853 10:5970999-5971021 ATTAAATGTATTATCTCTGGAGG - Intronic
1064619685 10:17202265-17202287 ATTCACTGTGTATTCTATGTAGG - Intergenic
1065679010 10:28209861-28209883 ATTCAAAGGATAATCTCTTTCGG - Intronic
1069271983 10:66540150-66540172 ATAGAATATATAATCTATTTAGG + Intronic
1070055542 10:72930900-72930922 ATTTAATTTAAAATCTTTGTGGG + Intronic
1071099275 10:82016120-82016142 ACTCAGTGTATAAAATATGTGGG + Intronic
1071180509 10:82978217-82978239 TTTCTGTGCATAATCTATGTAGG + Intronic
1072353904 10:94586989-94587011 AATCATTGTATACTCTAGGTCGG - Intronic
1074923236 10:118040220-118040242 ATTCAATGTCTGATTTATCTGGG - Exonic
1075570796 10:123541929-123541951 ATTGAATCTATAATCAATTTAGG + Intergenic
1079197348 11:18341225-18341247 ATTCAGTATATAATATTTGTGGG + Intronic
1080201752 11:29679566-29679588 GTTCCATGTATAATCCATTTTGG - Intergenic
1080268825 11:30428808-30428830 ATTTAATTTTTAATCTATATAGG - Intronic
1080975668 11:37337332-37337354 ATTCAAGAAATGATCTATGTTGG + Intergenic
1081077955 11:38699029-38699051 TTTAAATGTGTAATCTATTTGGG + Intergenic
1084480682 11:69418267-69418289 ATTCAATTTTTAATTTCTGTGGG - Intergenic
1085842301 11:80026679-80026701 TTTTAATGTATAATATATGTTGG - Intergenic
1085945938 11:81273183-81273205 ATTCAATCTTTAATCTTTGGAGG + Intergenic
1086276527 11:85136279-85136301 ATTAACTGGATAATGTATGTAGG + Intronic
1087525564 11:99306515-99306537 AAACAATATATAATCTATATTGG - Intronic
1092508975 12:9133569-9133591 ACTGAATGCACAATCTATGTTGG - Intergenic
1093258846 12:16908197-16908219 ATTATATGTATAATTTATTTGGG - Intergenic
1095923046 12:47550280-47550302 ATTCAATGTTTAATTTTTTTAGG - Intergenic
1096484031 12:51965081-51965103 ACTCTATGTGTAATTTATGTTGG + Intronic
1098766040 12:74490308-74490330 TTTCAATTTATAATATATGGAGG - Intergenic
1098827486 12:75315558-75315580 ATTCAATATATATTTTATTTGGG - Intronic
1099357053 12:81650572-81650594 ATTAAATGTATAATTTAGGGAGG + Intronic
1099815586 12:87643023-87643045 ATTCACGGTATCATCTATGAGGG + Intergenic
1101250340 12:102928151-102928173 TTTTAATGTTTAATATATGTGGG + Intronic
1101438616 12:104685627-104685649 ATTATATGTTTAATGTATGTGGG + Intronic
1101530965 12:105573396-105573418 ATTCAATGTATGAATTTTGTGGG + Intergenic
1105961605 13:25346353-25346375 AGTCTATGTAGAGTCTATGTAGG + Intronic
1107346297 13:39464927-39464949 ATTCAGTGTATATTATATCTGGG + Intronic
1108197147 13:48006321-48006343 ATTCTATGTATTAGCTTTGTTGG - Intergenic
1108533155 13:51346245-51346267 ATTCAAGGTATGGTCTTTGTAGG - Intronic
1109936397 13:69291318-69291340 ATTAAATGTATATTTTAGGTTGG - Intergenic
1110928317 13:81183611-81183633 ATTCACACTGTAATCTATGTGGG - Intergenic
1111499819 13:89103574-89103596 TTTCTATGTGTAATATATGTTGG + Intergenic
1111818308 13:93182791-93182813 CTTGAATGTATTACCTATGTGGG - Intergenic
1112102612 13:96206383-96206405 ATTGAATGTATAAACTACTTTGG - Intronic
1112648023 13:101357609-101357631 ATTGAATCTATAATTTATTTTGG - Intronic
1115940806 14:38608001-38608023 AATCAATGTATTTTGTATGTAGG - Intergenic
1116614308 14:47114348-47114370 ATTGAATGTATAAATTATATTGG - Intronic
1116692143 14:48122037-48122059 ATTAAATGTTAAATCTATGAGGG + Intergenic
1116850600 14:49904966-49904988 TTTAAATGTATAAAATATGTAGG - Intergenic
1117168177 14:53060988-53061010 ATTCAACATATACTATATGTTGG - Intronic
1117517634 14:56518259-56518281 ATTAAATGTAGAATCTAGGCAGG + Intronic
1119255355 14:73190924-73190946 TTTCAATGTTTACTCTATTTTGG + Intronic
1121847318 14:97184253-97184275 ATTCTAAGTAGAAACTATGTTGG - Intergenic
1124800604 15:32829227-32829249 ATGCAATATATAATCTAAGATGG + Intronic
1124836899 15:33204078-33204100 ATCAAATGTTTAATTTATGTGGG - Intergenic
1125398048 15:39271141-39271163 ACTCATTGTAAAGTCTATGTGGG + Intergenic
1127378986 15:58412063-58412085 AAAAAATGTGTAATCTATGTTGG - Intronic
1130838160 15:87672180-87672202 CTTCAATGCATAATCTATGAAGG + Intergenic
1135997901 16:27266968-27266990 ATCCCATGTATAATATAGGTTGG + Intronic
1137378472 16:47975728-47975750 ATTTAGTGTTTATTCTATGTTGG + Intergenic
1139275190 16:65720753-65720775 ATTCAAAGAATGATCTGTGTTGG - Intergenic
1140555171 16:75913241-75913263 TTTGAATGTATATTCTATGAAGG + Intergenic
1143691920 17:8575171-8575193 ACTCAAAGTAAAATCTAGGTGGG + Intronic
1143745550 17:8991569-8991591 TTTCCATGAATAATCAATGTAGG - Intergenic
1145303829 17:21659073-21659095 TTCCAACGTATAATCTATGTTGG + Intergenic
1145325832 17:21824021-21824043 AGTAAATGTATCATCTATTTAGG - Intergenic
1145346202 17:22042748-22042770 TTCCAACGTATAATCTATGTTGG - Intergenic
1146080659 17:29777521-29777543 ATTCTTTGTATAATGAATGTAGG - Intronic
1149137926 17:53392400-53392422 ATTCTATGTATAAACCATCTAGG - Intergenic
1153427050 18:4976309-4976331 ATAGAATGTATAATGAATGTGGG - Intergenic
1153527074 18:6007517-6007539 AATCAATATATTATGTATGTTGG + Intronic
1156664360 18:39387697-39387719 AGTCAATTTATAATATATATTGG - Intergenic
1156695281 18:39758900-39758922 ATTCTATGTTTAAGATATGTAGG - Intergenic
1156820661 18:41368829-41368851 ATATAATGTATATTTTATGTGGG - Intergenic
1159983782 18:74818443-74818465 ATTGCATGTGTAATATATGTAGG - Intronic
1162603241 19:11686740-11686762 ATTAGAAGTATCATCTATGTTGG + Intergenic
1164269894 19:23663197-23663219 AGTCAAATTATAATCTCTGTTGG - Intronic
1164791451 19:30988276-30988298 AAACAATGTATTATCTATGGAGG - Intergenic
1165808338 19:38595800-38595822 ATTCAGTGTGAAAGCTATGTAGG + Intronic
925232811 2:2250839-2250861 ATTCAATGGATAAATTATGCTGG - Intronic
926257117 2:11214497-11214519 ATTGAATGTATATACTTTGTGGG - Intronic
926698575 2:15787603-15787625 ATTGAATGAATAGTCTGTGTGGG - Intergenic
927809817 2:26174602-26174624 ATTCAATCCATAATCTTTATTGG - Intronic
928164864 2:28963341-28963363 ACTCAGTGTATGATCTATCTTGG + Intronic
928218409 2:29381766-29381788 ACTCAATGTCTATTCGATGTAGG - Intronic
928474177 2:31608173-31608195 ATAAAATTTATAATATATGTTGG + Intergenic
928997393 2:37307651-37307673 AATCAATGTATCATAAATGTTGG + Intronic
929638929 2:43556036-43556058 AGTCACAGTATAATTTATGTAGG + Intronic
932464541 2:71908094-71908116 ATTTACTGTTTAATATATGTGGG - Intergenic
932523020 2:72433472-72433494 ATTCAATGTATAAATTACTTGGG + Intronic
933646495 2:84817222-84817244 AGACAATGTATAATATATGCTGG + Intronic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
938171540 2:129081545-129081567 ATTCTAATTATATTCTATGTTGG + Intergenic
939246981 2:139637536-139637558 AATCAATGTATATTCTATGAAGG + Intergenic
939409020 2:141799932-141799954 AATAAATGTATAATTTATATAGG - Intronic
939754848 2:146097364-146097386 ATTCAATAAATACTGTATGTGGG - Intergenic
939767579 2:146270472-146270494 ATGAAATGTATATCCTATGTTGG - Intergenic
941613714 2:167694178-167694200 TTTCAATGTATAAATTCTGTAGG + Intergenic
942199562 2:173557545-173557567 ATACAATGTATAATGTATAATGG + Intergenic
942216198 2:173721133-173721155 ATTCAAAGTATAATCTCTGATGG + Intergenic
942486831 2:176448774-176448796 ATTACATGGATAATATATGTGGG + Intergenic
942963156 2:181857215-181857237 ATACAATGTATAATCCATTATGG - Intergenic
944726564 2:202477204-202477226 ATTGAATGTCTTCTCTATGTGGG - Intronic
945219481 2:207469170-207469192 ATTCAATGGACAATCTTTGGAGG - Intergenic
945572743 2:211490327-211490349 ATTCAATATATAACTTATTTAGG - Intronic
947358952 2:229327036-229327058 ATTCAGCATATAATCTATATTGG - Intergenic
1170068231 20:12338827-12338849 AGGCAATGTCTAATTTATGTAGG + Intergenic
1171074718 20:22110816-22110838 ATACAATGTACAATTTATGAAGG - Intergenic
1171736306 20:28789878-28789900 ATTGAATCTATAAATTATGTAGG + Intergenic
1172555046 20:35833595-35833617 ATTGAATGTCTAATATATGCAGG + Intronic
1172830167 20:37827092-37827114 ATTCAGTGTATATTCTTTTTGGG + Intronic
1173093404 20:39998948-39998970 ATATAATATATAATCTATATTGG - Intergenic
1175555386 20:59850259-59850281 TTCCAATGTATAATAAATGTAGG - Intergenic
1176655190 21:9581831-9581853 TTCCAACATATAATCTATGTTGG + Intergenic
1178560015 21:33629905-33629927 ATTCTATGCCTAATTTATGTAGG + Intronic
1178775517 21:35546626-35546648 ATTAATTGTATATTCCATGTGGG - Intronic
1179835942 21:44033558-44033580 ATTAAATGGAGAAACTATGTAGG + Intronic
1183008813 22:34927869-34927891 ATTTAATTTATAATTTTTGTGGG - Intergenic
949310437 3:2691350-2691372 ATTTTATGTATAATATATGATGG + Intronic
950701405 3:14751906-14751928 ATTGAATGTATAAATTATCTTGG - Intronic
951435919 3:22664296-22664318 ATTCAATGTTAGATCTATGATGG + Intergenic
951491768 3:23278594-23278616 TTTTAATGTATAATATATCTGGG + Intronic
951719028 3:25679106-25679128 TTTCAAAGTATAATTTATCTGGG + Intergenic
951841304 3:27036824-27036846 TTTGAATGCCTAATCTATGTAGG + Intergenic
952161506 3:30698116-30698138 ATGCAAGGTATAATCTTTGCTGG + Intergenic
953101875 3:39837782-39837804 ATTGAATGTATAAACTACTTTGG + Intronic
953893095 3:46770214-46770236 ATCCAATATATAATCTATCTTGG - Intronic
955208631 3:56920082-56920104 AATCTATGTAGAATTTATGTTGG - Intronic
956203623 3:66733336-66733358 TTTCAATGTCTACTATATGTAGG + Intergenic
956429991 3:69177033-69177055 ATTCAAAAAATAATCTAGGTTGG + Intronic
957015409 3:75057888-75057910 ATAAAATGTATGATATATGTAGG + Intergenic
958105734 3:89070211-89070233 ATTGAATGTATAAATTATCTTGG + Intergenic
958455914 3:94330703-94330725 AATCAATGTATAATCCATTTTGG - Intergenic
961848054 3:129785330-129785352 ATTCTATGTATATTCTAACTTGG - Intronic
964674133 3:159258608-159258630 ATTCAATGTATCCTCTCTGATGG + Intronic
965196757 3:165607925-165607947 AACAAATGTATAATATATGTTGG - Intergenic
965479604 3:169201645-169201667 ATTCAATATATAAATCATGTTGG + Intronic
965967858 3:174517728-174517750 ATTCCTTGTATCATCAATGTAGG - Intronic
966073509 3:175907591-175907613 ATTGAATGTATAAATTATATTGG - Intergenic
966476456 3:180353787-180353809 ATTCAATTTATAAATAATGTAGG + Intergenic
967070105 3:185955569-185955591 AGGCAATGTATGATTTATGTAGG + Intergenic
968823558 4:2875899-2875921 ATTCATTGTACAATCTTTCTAGG - Exonic
970732269 4:19120265-19120287 AACCAATGCATAATCTAAGTGGG - Intergenic
971574215 4:28253515-28253537 ATTCAATATATAAATTCTGTGGG + Intergenic
972979829 4:44683331-44683353 TTTCAAAGTATAATCTTTTTAGG - Intronic
973309390 4:48691794-48691816 ATACAGTGTTTAATTTATGTAGG - Intronic
974190785 4:58499754-58499776 ATTAAATGTAAAATCCATCTTGG - Intergenic
975918884 4:79358948-79358970 ATTGAATGTATAATATTTGTTGG + Intergenic
976835766 4:89371338-89371360 AATCAAAATAAAATCTATGTTGG + Intergenic
978157522 4:105506662-105506684 ATTCAAAGAATAAGCTATGTGGG - Intergenic
978306871 4:107338575-107338597 ATTCAGTTTATAATATATTTTGG - Intergenic
978363488 4:107956189-107956211 ACTCAATGTATGATCTATCCTGG - Intergenic
979050117 4:115920262-115920284 CTTAAATGTATTGTCTATGTAGG - Intergenic
981452405 4:144913492-144913514 ATTCAATGTATAGTGTATCCTGG + Intergenic
982613805 4:157614557-157614579 ACTCAATGTCTAATCCATGTCGG - Intergenic
983056941 4:163108781-163108803 ATTCAGTGAATACTCTCTGTGGG + Intergenic
983787666 4:171754136-171754158 ATGAAATGTATAATCTTTGGTGG - Intergenic
985305644 4:188536390-188536412 ATACAATGTATAGTCTAATTTGG - Intergenic
987814824 5:22886397-22886419 AATCAAAGTAGAATCTATTTAGG - Intergenic
987999221 5:25329125-25329147 ATTCATTGTATAATCTGAGGGGG - Intergenic
988415273 5:30939309-30939331 TTTCAATGTTTAATTTTTGTGGG - Intergenic
989250002 5:39302071-39302093 ATTAAATGTATAAACAGTGTTGG + Intronic
989515254 5:42336297-42336319 ATTAAATCTATAAACTAAGTTGG - Intergenic
990044772 5:51415757-51415779 ATACATTGAATAATCTCTGTGGG - Intergenic
990510500 5:56485104-56485126 ATTTTATATATAATATATGTTGG - Intergenic
992962550 5:81970946-81970968 ATTAAATGGATAATCTAAATTGG + Intergenic
993181277 5:84556132-84556154 AATCAATGTATAAACTAATTTGG + Intergenic
993947590 5:94134029-94134051 ATTGAATCTATAAACTATCTTGG + Intergenic
994512130 5:100717713-100717735 ATTCCATGTATTTTCTATGTTGG + Intergenic
996019862 5:118579209-118579231 ATTATCTGGATAATCTATGTGGG - Intergenic
996114567 5:119603880-119603902 ATTGAATCTATAATCTACCTTGG - Intronic
997974671 5:138433722-138433744 ATACAAAGTATAATCAACGTTGG + Intronic
998796944 5:145830667-145830689 ATCCAATGAATAAACTATTTTGG + Intronic
999973208 5:156885427-156885449 ATTCCATCTATAATATCTGTGGG + Intergenic
1001000336 5:167999950-167999972 ACTCAATGTATACTCTGTGGAGG - Intronic
1001360669 5:171082998-171083020 GTTCAATTTATAATCCCTGTTGG - Intronic
1002144748 5:177170785-177170807 ATTTAATGGATAGTTTATGTTGG - Intronic
1003747597 6:9020680-9020702 TTTCAATGTATAATTTTTATTGG + Intergenic
1005242468 6:23847300-23847322 ATTGAATCTATAAATTATGTTGG - Intergenic
1008315460 6:50034149-50034171 CTTCAATGTCTAATCTCTTTAGG - Intergenic
1009717448 6:67417013-67417035 ATATAAGGTATAATCTATGTAGG - Intergenic
1009877545 6:69523934-69523956 AAACAAAGAATAATCTATGTGGG + Intergenic
1011864528 6:91807552-91807574 ATTCAATTTTTAATTTTTGTGGG + Intergenic
1012100107 6:95073148-95073170 ATCCAATATATAATCTATATTGG + Intergenic
1012135271 6:95548189-95548211 ATCCAATGATTAATCTGTGTAGG - Intergenic
1012316573 6:97788326-97788348 ATTGAATCTATAATCAATTTTGG + Intergenic
1012336176 6:98061011-98061033 ATTGAATCTATAAATTATGTTGG + Intergenic
1012426874 6:99124401-99124423 ATTCATTTTATAATGTGTGTAGG - Intergenic
1012537450 6:100315966-100315988 AATCAATATATATTCTATGTAGG - Intergenic
1013203127 6:107920693-107920715 ATTCAATGTAAGAGCTATGTGGG + Intronic
1013203391 6:107923843-107923865 AAGCAATGTAAAATCTAGGTTGG - Intronic
1014301892 6:119692306-119692328 ATTGAATCTATAAATTATGTTGG + Intergenic
1016135035 6:140530591-140530613 ATTTAATGTCTATTCTATCTAGG - Intergenic
1016568529 6:145486554-145486576 ATACAAAGTAGAAACTATGTAGG - Intergenic
1016580587 6:145625534-145625556 ATTAAATTTTTAAACTATGTGGG - Exonic
1017264202 6:152423449-152423471 AGTCAATGTATAGTGTGTGTTGG - Intronic
1017394204 6:153977883-153977905 ATTTAATGAATAATCAATTTTGG - Intergenic
1018272047 6:162090500-162090522 GTTCAATGGATAATATATATAGG - Intronic
1018578654 6:165287354-165287376 ATTGAATGTATAAGCTACTTTGG - Intronic
1018984827 6:168628593-168628615 AATAAAAGTATAATTTATGTTGG - Intronic
1020887499 7:13836401-13836423 ACTCAGTGTATAATCTCTGATGG - Intergenic
1021277048 7:18664455-18664477 ATACAATTTATAATATATTTGGG - Intronic
1021291965 7:18856488-18856510 ATTGATTTTATAAACTATGTAGG + Intronic
1021313963 7:19123372-19123394 ATTCAATTTATAATTAAGGTTGG + Intergenic
1021796654 7:24262178-24262200 ATTGAATCTATAATCAATTTGGG + Intergenic
1023182613 7:37500212-37500234 ATTCTATGTTTAATCTATTAAGG - Intergenic
1024695334 7:51850471-51850493 ATTCACTGAAAAATCTATATTGG + Intergenic
1024769651 7:52705764-52705786 ATTCAATGCATAATAAATGCAGG + Intergenic
1025281827 7:57631676-57631698 TTCCAACATATAATCTATGTTGG + Intergenic
1025302902 7:57833841-57833863 TTCCAACATATAATCTATGTTGG - Intergenic
1027381110 7:77610394-77610416 ATTCAATGTATAATCTATGTGGG - Intronic
1027968255 7:85041503-85041525 ACTCAATGTATACTTTAAGTTGG + Intronic
1028742899 7:94296917-94296939 ATTCAATGTAAAATCAATACTGG + Intergenic
1030937099 7:115598152-115598174 ATTGAATCTATAAATTATGTTGG - Intergenic
1031352177 7:120747124-120747146 ATGAATTGTATACTCTATGTGGG - Intronic
1032381654 7:131490134-131490156 ATTTAAATTATAATCTATGCTGG - Exonic
1037422112 8:18713705-18713727 ATTGAATGTATAAATTATTTTGG - Intronic
1037626639 8:20613383-20613405 ATTGAATCTATAATCTACTTTGG + Intergenic
1038711946 8:29955418-29955440 ATTGGATGTATAATCTATGTGGG - Intergenic
1039628639 8:39083156-39083178 ATTAAATGTATAACTGATGTGGG - Intronic
1040633017 8:49238420-49238442 ATTCAATTTAAAATTGATGTTGG - Intergenic
1040904166 8:52448391-52448413 ATTGAATGTATAAACTATTTGGG + Intronic
1041504186 8:58576315-58576337 ATACAAACTATAATATATGTAGG - Intronic
1043208719 8:77482988-77483010 ATTAAATGTTTAAACTATATAGG - Intergenic
1044002366 8:86899203-86899225 ATACAAAGTAGAATATATGTAGG + Intronic
1044261134 8:90123329-90123351 ATTAAATTTATAAATTATGTTGG + Intergenic
1044519381 8:93180116-93180138 ATTGGATGTATAGTCTATGAGGG - Intergenic
1046250813 8:111628643-111628665 ATTCAAAATATAATAGATGTTGG + Intergenic
1046259595 8:111750338-111750360 GTCCAATATATAATCTATCTTGG - Intergenic
1046373164 8:113338332-113338354 ACTCTATGTATAATCTATTGAGG - Intronic
1046865716 8:119148126-119148148 TTTCAATGTAATTTCTATGTAGG - Intergenic
1047930343 8:129722304-129722326 CTTTAATGAATAATCAATGTGGG + Intergenic
1048229762 8:132627121-132627143 ATTGAAAGAATAATCTATGAAGG + Intronic
1050323157 9:4474551-4474573 TTTCAATCTAAAATCTATCTGGG - Intergenic
1050918837 9:11173022-11173044 ATTCAATTGAAAATCTCTGTGGG - Intergenic
1051380074 9:16448502-16448524 ATTCAAAGTATAATATGTGAAGG - Intronic
1052889070 9:33679727-33679749 ATATAATATATAATCTATATGGG + Intergenic
1053334736 9:37256944-37256966 ATCCAATGAAGAATCTATGAGGG - Intronic
1056453935 9:86742517-86742539 GATAAATGTATAATTTATGTTGG + Intergenic
1057924842 9:99136200-99136222 ATCCACTGTATTATCTATATTGG - Intronic
1058036121 9:100254983-100255005 ATTGAATCTATAAATTATGTTGG + Intronic
1058227941 9:102389869-102389891 ATTCAATATATAATTGCTGTGGG - Intergenic
1059636088 9:116172056-116172078 ATTTAATGCATAATATGTGTCGG + Intronic
1059944396 9:119394085-119394107 TTTAAATCTATCATCTATGTTGG - Intergenic
1060252385 9:121996655-121996677 ATTTAATGTATTATTTAGGTTGG - Intronic
1203632912 Un_KI270750v1:85303-85325 TTCCAACATATAATCTATGTTGG + Intergenic
1188764685 X:34076975-34076997 AATCAATGTTAAATATATGTTGG + Intergenic
1188997382 X:36902652-36902674 ATAAAATGTATAATTTAAGTTGG - Intergenic
1189088959 X:38057833-38057855 ATTCTACGTACAAGCTATGTTGG + Intronic
1189421061 X:40858327-40858349 TTTCAATGTTTAATTTTTGTGGG + Intergenic
1191083228 X:56536683-56536705 ATACAATGTATTATATATATAGG - Intergenic
1191233103 X:58112664-58112686 ATTGAATGTATAAATTATCTTGG - Intergenic
1193245193 X:79220161-79220183 ATTCAATTTAAAACCTATGGGGG - Intergenic
1193644610 X:84052227-84052249 GATCAATATATAATCTATTTTGG + Intergenic
1195763854 X:108275712-108275734 ATGCAATGTATAATCTAAGGGGG + Intronic
1196399917 X:115304158-115304180 ATTCAATGCCTACTCTATGCAGG + Intronic
1196633132 X:117966484-117966506 ATTGAATCTATAAATTATGTTGG - Intronic
1197021461 X:121695104-121695126 TTTTAATATTTAATCTATGTTGG + Intergenic
1197062455 X:122196873-122196895 ACGCAATGTATAATCTATCCTGG - Intergenic
1197940747 X:131786216-131786238 ATTGAATGTAAAATGTGTGTGGG - Intergenic
1199155509 X:144542758-144542780 TTTTAATGTTTAAGCTATGTGGG + Intergenic
1199165161 X:144663921-144663943 ATTGAATGTATAAACTGTTTGGG + Intergenic
1199459244 X:148065488-148065510 CTTCAAGGTTTAATCTTTGTAGG + Intergenic
1200020086 X:153196056-153196078 TTTCAATTTTTAATCTTTGTGGG + Intergenic