ID: 1027381513

View in Genome Browser
Species Human (GRCh38)
Location 7:77614917-77614939
Sequence TTTTAGTTTGATATACTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027381512_1027381513 -2 Left 1027381512 7:77614896-77614918 CCAGTATTATTTCTGTAGAAATT 0: 1
1: 0
2: 4
3: 50
4: 480
Right 1027381513 7:77614917-77614939 TTTTAGTTTGATATACTAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027381513 Original CRISPR TTTTAGTTTGATATACTAGT TGG Intronic
904694978 1:32324612-32324634 TTTTAGGCTGCTATCCTAGTTGG + Intronic
905970656 1:42139562-42139584 TTTAATTTTAATATTCTAGTGGG + Intergenic
906353397 1:45082369-45082391 TTTAAGTTTGAGATACTTCTAGG - Intronic
907189395 1:52635569-52635591 TTTCATTTTGATAGACCAGTTGG - Intronic
909834963 1:80242460-80242482 TTTTATTTTGTTATACAAGGAGG - Intergenic
911436261 1:97862777-97862799 TTTTAATTTGATATAATATTAGG - Intronic
914429351 1:147606280-147606302 ATTTATTTTCATATACTTGTGGG - Intronic
916860375 1:168797466-168797488 TTTTAGTTTGAAATAATTATTGG + Intergenic
917375339 1:174347047-174347069 TTTTAGTTTTATTTAGTTGTGGG + Intronic
918759686 1:188387243-188387265 TTTTAGTTTTACATATTTGTAGG - Intergenic
918909774 1:190552064-190552086 TTTTAGTTTGAAATAATTTTAGG + Intergenic
919226779 1:194714193-194714215 TTTTAGTATGATATCCTCATTGG + Intergenic
921111176 1:212038364-212038386 TTTGAGTTTGAGATGCTTGTGGG - Intronic
921779935 1:219150885-219150907 ATTTATTTTGTTTTACTAGTAGG + Intergenic
923198749 1:231692017-231692039 TTTTACGCTGATATACTTGTAGG + Intronic
1063250267 10:4265826-4265848 TTCCTGTTTGATATTCTAGTTGG + Intergenic
1063850691 10:10186469-10186491 TTTTTGTTTGAGATATAAGTAGG + Intergenic
1065056448 10:21848220-21848242 ATTTATTTTCATATACTTGTTGG + Intronic
1066328060 10:34386207-34386229 TTTTAGACTCATACACTAGTAGG - Intronic
1066751128 10:38658663-38658685 TTTTGGGTTGATATGCTAGTTGG - Intergenic
1066965916 10:42264428-42264450 TGTTGGGTTGATATGCTAGTTGG + Intergenic
1068466630 10:57401316-57401338 TCTTAGCTTGATATACAAATTGG - Intergenic
1068482722 10:57614123-57614145 TTTTAGTTTGATATAATCCCAGG - Intergenic
1068998842 10:63240664-63240686 TTTTAGTTTTTTATATTAGAGGG + Intronic
1069103626 10:64355902-64355924 TTTTAGTTTAATAAAATAATGGG + Intergenic
1071002321 10:80844079-80844101 TTTTACTTGGATCTACTTGTTGG + Intergenic
1071241916 10:83716467-83716489 TTTTATTTTGAGATAATATTAGG - Intergenic
1072129520 10:92480408-92480430 TTTAAATTTGACATATTAGTTGG + Intronic
1072602951 10:96948221-96948243 TTTTATTTTTTTTTACTAGTTGG + Intronic
1073846252 10:107558469-107558491 TTTTACTTTGCAATGCTAGTAGG - Intergenic
1075309636 10:121402707-121402729 TTTTATTTTGAGATAATTGTAGG - Intergenic
1076625648 10:131820049-131820071 TTTTATTTGGATATAATTGTAGG - Intergenic
1077276174 11:1709992-1710014 TTTTAGTTTGAAATAATTTTGGG - Intergenic
1078158481 11:8818807-8818829 TTTTAGTTGGATTGATTAGTTGG - Intronic
1078918614 11:15805416-15805438 TATTAGTTTCATTTACTACTTGG + Intergenic
1080203726 11:29705596-29705618 AATTAGTTTTATATACTATTGGG - Intergenic
1081221401 11:40467846-40467868 TTCAAGTGTGATATACTAGGAGG - Intronic
1081879087 11:46432694-46432716 TTATAGTTGGATGTACTTGTTGG - Intronic
1086040054 11:82465398-82465420 TTATAGTTTGATAGATTAGTGGG - Intergenic
1086113786 11:83225923-83225945 TTTTAGTTATATATATGAGTTGG + Intronic
1086219808 11:84428890-84428912 TTTTAGTTTGATGTCATTGTTGG + Intronic
1087550893 11:99646699-99646721 TTTCAGTGAGATATACTAATGGG - Intronic
1088601112 11:111476860-111476882 TCTTAGTTTGATTTAATATTGGG + Intronic
1090164826 11:124535904-124535926 TTTTAGTTTGAATTTCCAGTGGG + Intergenic
1090169701 11:124589894-124589916 TTTTATTTTCAAATACTAGAAGG - Intergenic
1090952862 11:131488734-131488756 TTTTGGTTTGATGTAATAATGGG - Intronic
1091248689 11:134123050-134123072 TTTTATTTTGATAAATTAGTGGG - Intronic
1092451593 12:8607421-8607443 TTTGAGTTTGAGGTACAAGTTGG - Intronic
1093543953 12:20322335-20322357 TTTTATTTTGAGAGACTAGCTGG - Intergenic
1093638203 12:21496052-21496074 TTTTAGTTTGCTGTATTGGTTGG - Intronic
1098342276 12:69464684-69464706 TTTTTATTTGATTTAATAGTTGG + Intergenic
1098957937 12:76706727-76706749 TTTTAGTTTAATATAGTAAGTGG - Intergenic
1099108543 12:78526318-78526340 TTTTAGTTTGAAATACAATATGG + Intergenic
1099417584 12:82411039-82411061 TTTTAGTTCAATATAATAGGAGG - Intronic
1100683590 12:96959564-96959586 ATATAGTTTGATAGACTACTGGG - Intergenic
1102840427 12:116113982-116114004 TTTTATTTTGATATACTTTATGG + Intronic
1106592902 13:31112260-31112282 TTTTAGTGTAATATTCTGGTTGG + Intergenic
1106669683 13:31891134-31891156 TTTTAATATGATATTCAAGTGGG - Intergenic
1107215825 13:37917390-37917412 TTTTATTTTGTGATACTTGTAGG - Intergenic
1107271374 13:38621537-38621559 TTTAAGTTTTATACACTGGTAGG - Intergenic
1107772055 13:43797911-43797933 TTTTATTTTTATATAGTAATAGG - Intergenic
1109149571 13:58829075-58829097 GTTGAGTTTCAGATACTAGTTGG + Intergenic
1109524625 13:63558784-63558806 TTTTAGTTTAATATATAAGAAGG + Intergenic
1109637559 13:65142752-65142774 TTTTATTTTGACATAATACTAGG - Intergenic
1111413071 13:87902239-87902261 TTTAAGTTTGATAAAGTATTTGG + Intergenic
1111775744 13:92659301-92659323 TTGTAGTTTCATATACAATTTGG + Intronic
1112068245 13:95817877-95817899 TTTTAATTTCCTATAGTAGTGGG - Intronic
1112790562 13:102997902-102997924 TTTTATTTTGATGTACTTGGAGG + Intergenic
1112941029 13:104861916-104861938 CTGTAGTTTGATAAACTATTTGG - Intergenic
1113380691 13:109802913-109802935 TTCTAGTTTGATTTATAAGTAGG + Intergenic
1114369640 14:22071686-22071708 TTTTACTTTGCTGCACTAGTGGG - Intergenic
1114894927 14:26975737-26975759 TTTTAGTTTGAGATATTTCTGGG + Intergenic
1115462918 14:33682076-33682098 TTTTAATTTCATTTATTAGTTGG - Intronic
1116187357 14:41613997-41614019 TATTAATGTGATTTACTAGTGGG + Intronic
1120219588 14:81717217-81717239 TTTCCGTTTGATATAAAAGTTGG + Intergenic
1120423694 14:84320221-84320243 TTTTTTTTTGATGTACTATTGGG - Intergenic
1120839687 14:89074182-89074204 TTTTAATTTTATATAGTAGTAGG + Intergenic
1120839815 14:89075713-89075735 TTTTAATTTTATGTAGTAGTAGG - Intergenic
1120840001 14:89077366-89077388 TTTTAATTTTATGTAGTAGTAGG - Intergenic
1124473902 15:30014207-30014229 TCTTTTTTTAATATACTAGTTGG + Intergenic
1126887923 15:53171962-53171984 TTTTATTTTGTTATAGTAGCTGG + Intergenic
1127009908 15:54613173-54613195 TTTTAATTTTATATACTAATTGG - Intronic
1127166379 15:56247824-56247846 TTTTATTTTTATATTCAAGTTGG - Intronic
1127648082 15:60977216-60977238 ATTTAGTTTGAGGTACTGGTGGG + Intronic
1128947265 15:71835549-71835571 CTTTAGTTTGAATTACTACTAGG - Intronic
1130874609 15:88002480-88002502 TGTTAGTTAGATATATTAATTGG - Intronic
1132201713 15:99959324-99959346 TGTTAGTTTGAGATGTTAGTGGG - Intergenic
1134389062 16:13801963-13801985 TTTTCGGTTGTTGTACTAGTGGG + Intergenic
1136513679 16:30755061-30755083 TTTTAGTTTGTTCTACCACTCGG - Intronic
1136731597 16:32418442-32418464 TGTTGGGTTGATATGCTAGTTGG + Intergenic
1137330844 16:47493857-47493879 TTTTATTTTGAACTACTAGTTGG - Intronic
1140057103 16:71535160-71535182 TTTTATTTTGTTATATTTGTGGG + Intronic
1140160142 16:72481836-72481858 TTTTATTTTGAGATAATTGTAGG - Intergenic
1202994793 16_KI270728v1_random:98828-98850 TGTTGGGTTGATATGCTAGTTGG - Intergenic
1203021480 16_KI270728v1_random:411170-411192 TGTTGGGTTGATATGCTAGTTGG - Intergenic
1143396225 17:6600138-6600160 TTTTAGTTTGGGAAACAAGTTGG - Intronic
1144253338 17:13441094-13441116 TTTTATTTTGAATTAGTAGTGGG + Intergenic
1149331087 17:55582650-55582672 TTTTTGTTTTATTTACTAATGGG + Intergenic
1149668646 17:58385317-58385339 TTTAAGTTTGAGATATCAGTAGG - Intronic
1150203786 17:63384691-63384713 TTTTACTTTAATTTAATAGTTGG + Intronic
1153452767 18:5248099-5248121 TTTTAGTGTGATGTACTTCTTGG - Intergenic
1153853069 18:9115027-9115049 ATTTAATTTGATATACAAGGAGG + Intronic
1155903539 18:31421271-31421293 TATTAGATTGATATATTATTGGG + Intergenic
1156144754 18:34161606-34161628 TTTTTTTTTCATATACTTGTTGG + Intronic
1157543591 18:48531390-48531412 TTCTATTTTTATATATTAGTAGG + Intergenic
1157708066 18:49825496-49825518 CTTTAGTTTGTTTTACTATTTGG + Exonic
1159667687 18:71182686-71182708 TTTTTGTTTGATCTACTACGTGG + Intergenic
1159680706 18:71348194-71348216 TTTCAGTTTGTTATATTAGAAGG - Intergenic
1161833548 19:6628896-6628918 TTTTACTTTGGAATTCTAGTTGG + Intergenic
1166580645 19:43895661-43895683 ATCTATTTTGATATACTATTGGG + Intronic
925800133 2:7590946-7590968 TTTTCCTTTGATCTTCTAGTAGG - Intergenic
926461612 2:13136425-13136447 TTTGAGTTTTATATCCTACTAGG + Intergenic
927348909 2:22083020-22083042 TTTTACATTGATATAGGAGTAGG + Intergenic
932166944 2:69516835-69516857 TTGTAGTATGCTATGCTAGTTGG + Intronic
933360939 2:81283130-81283152 TTTTAGTTTGCTTTCCTTGTAGG - Intergenic
934314123 2:91900832-91900854 TGTTGGGTTGATATGCTAGTTGG - Intergenic
934864059 2:97790053-97790075 TTTTAGTATGAGATACCAGGGGG + Intronic
937144867 2:119635988-119636010 TTTTAGTTTGGTTTCCTATTTGG - Intronic
937534238 2:122866448-122866470 TTTTGGTCTTATATTCTAGTGGG - Intergenic
938617064 2:133010301-133010323 TTTTAGTTTGGTATACATGCTGG + Intronic
939119258 2:138096912-138096934 TTTTAGTTAGATATAGGAGTGGG - Intergenic
939902964 2:147873072-147873094 TTTTAATTGGATGAACTAGTTGG + Intronic
941254447 2:163210958-163210980 TTTTTGTGTGACATACTAGTGGG + Intergenic
942031230 2:171962280-171962302 TTCTAGTTAGATATTCTGGTAGG - Intronic
944076063 2:195732317-195732339 TTTTAGTTTGAGATACCTATAGG + Intronic
945124619 2:206494716-206494738 TGTCAGGTTGAGATACTAGTGGG - Intronic
945134888 2:206616568-206616590 TTTTATTTTGAATTACTTGTGGG + Intronic
945766958 2:213992527-213992549 TTTCATTTTGATATAGTAGATGG + Intronic
947044335 2:225962752-225962774 TTTTAATTTGAGATAATTGTAGG - Intergenic
1169837826 20:9900183-9900205 TTTTAATTTTATATGCTAGTGGG + Intergenic
1170274052 20:14563552-14563574 TTTTATTTTGAGATAATTGTTGG + Intronic
1171146013 20:22783398-22783420 TTTTGGTTTGATCTTCTATTTGG - Intergenic
1173098136 20:40057694-40057716 CTTTAGTATGATATATCAGTAGG + Intergenic
1174197122 20:48781381-48781403 TTTTATTTTGAGATAATTGTAGG - Intronic
1175095990 20:56541923-56541945 TTTTCTTTTGAAATAATAGTAGG + Intergenic
1180540883 22:16446698-16446720 TGTTGGGTTGATATGCTAGTTGG - Intergenic
1181931717 22:26407133-26407155 TTTTATTATGGCATACTAGTGGG - Intergenic
1182800893 22:33031319-33031341 TTTTAGTTTGAACACCTAGTGGG - Intronic
1185205906 22:49538589-49538611 TTTTAGTTAAATATACCATTAGG + Intronic
949748474 3:7323865-7323887 CTATAATTTGATCTACTAGTTGG + Intronic
953267001 3:41400036-41400058 TTTTATTTTGAGATATTTGTAGG + Intronic
953280509 3:41550117-41550139 TTTTTGTTTGCTCTACCAGTAGG - Intronic
957336414 3:78835003-78835025 TTTAAATTTGTTTTACTAGTGGG + Intronic
957421434 3:79976960-79976982 GTTTTCTTTGATAAACTAGTTGG + Intergenic
958656974 3:97015021-97015043 TTTCAGTTTAATTTACTTGTTGG - Intronic
960106154 3:113799757-113799779 TTTTACTTTTATTTTCTAGTTGG - Intronic
960394950 3:117125492-117125514 TTTTATTTTGATATAATATCAGG - Intronic
961594162 3:128003970-128003992 TTTAAATTTCATTTACTAGTGGG - Intergenic
963184541 3:142398895-142398917 TTGTATTTTTATATACTAGCAGG + Intronic
964035827 3:152195490-152195512 TTTTAGTTTTATATTTAAGTTGG + Intergenic
965462282 3:168980989-168981011 TTTTAGTTTTATATTCAAGATGG - Intergenic
967309181 3:188090009-188090031 TTTTTGTTTGAGTTTCTAGTTGG - Intergenic
970393334 4:15639210-15639232 TTTTGGATTGATTTACTAGCTGG - Intronic
970500827 4:16675090-16675112 TTTTATTTTGAGATAATGGTAGG + Intronic
970636737 4:18019524-18019546 TTTTACTTGAATATACAAGTAGG + Intronic
971777661 4:30987771-30987793 TTTTATTTTTAAATATTAGTTGG + Intronic
971997276 4:33980746-33980768 TTTTTGTTTGTTTTACAAGTAGG - Intergenic
972107427 4:35507146-35507168 TTTAAGTTTATTATAATAGTAGG - Intergenic
972906644 4:43757050-43757072 TTTGTGTTTGATATACTTATTGG + Intergenic
974392143 4:61285144-61285166 TTTATGTCTGATATACTAGTTGG - Intronic
975714706 4:77194438-77194460 TTTTAGTTTTTTTTACTAATAGG - Intronic
975908277 4:79241574-79241596 ATTTACTTTTATATACTAGTCGG + Intronic
976407031 4:84671616-84671638 ATTTAATTTGTTCTACTAGTTGG - Exonic
978108854 4:104936965-104936987 TACTAGTTTGATATACAAGATGG + Intergenic
980465995 4:133182721-133182743 CTTTACTTTGAGATACTAATTGG + Intronic
981050430 4:140304377-140304399 TTCTAGTTAGATATCCTGGTAGG + Intronic
982604287 4:157494686-157494708 TTTTAGTTTCAACTAGTAGTTGG + Intergenic
982639447 4:157939279-157939301 TTTTATGTTGATATAGTAATTGG - Intergenic
983749156 4:171242863-171242885 TTTTAGTTTGAGAGAATTGTAGG - Intergenic
983870166 4:172816462-172816484 TTTTAGAATGTTATACTAATGGG + Intronic
984406369 4:179336812-179336834 ATATAGTTTTATATATTAGTAGG - Intergenic
986425770 5:7630059-7630081 TTTTAGTAAAAAATACTAGTCGG + Intronic
987108181 5:14661507-14661529 TTTTAGTTTGCTATTCTCATAGG + Intergenic
988869225 5:35370408-35370430 TTCTAGTTTGATGTATTAGATGG - Intergenic
990357854 5:54987987-54988009 TTGTAGTTTGGTTTACTATTTGG - Intronic
992560491 5:77947834-77947856 TTTAATTTTAATATAGTAGTTGG + Intergenic
992885780 5:81158748-81158770 TTTTATTTTGCTATTCTAATGGG - Intronic
994654780 5:102577974-102577996 TTTTATTTTGAGATACTTTTAGG + Intergenic
995521284 5:113008141-113008163 ATTTTAATTGATATACTAGTAGG + Intronic
996326393 5:122279445-122279467 TTTTAATTTGATATAATTGGAGG - Intergenic
999399259 5:151252122-151252144 TGTCAGGTTAATATACTAGTTGG - Intronic
1000073439 5:157762748-157762770 TTTTAGGTTGAGATACTGGCGGG + Intergenic
1004235183 6:13868743-13868765 TGTTTGTTTGAAATACTACTAGG + Intergenic
1005774162 6:29111937-29111959 TTTTAGTTGGATTTTCTAATTGG + Exonic
1005780056 6:29181556-29181578 TTTTAGTTGGATTTTCTAATTGG + Intergenic
1006560512 6:34907676-34907698 TTTTATTTTGAAATAATATTAGG - Intronic
1008716897 6:54299458-54299480 ATTAAGTTTGATATTTTAGTGGG - Intergenic
1009372143 6:62918423-62918445 TTTTTGTTTTATATATTAGGAGG + Intergenic
1010879009 6:81144956-81144978 TTTTATTTTGACATACAAGGAGG - Intergenic
1010900380 6:81421225-81421247 TTTTTATTTGACATTCTAGTGGG - Intergenic
1011151302 6:84276357-84276379 TTTTAGAGTGATATACTTGAAGG - Intergenic
1011525785 6:88263564-88263586 TTTAAGTTTGAGGTACTAGTGGG + Intergenic
1012326147 6:97920286-97920308 TTTTAATTTGCTGTTCTAGTTGG + Intergenic
1012446533 6:99312634-99312656 TTTTTGTTTGAGATAGTAGCTGG - Intronic
1014411073 6:121121996-121122018 TTGTTGTTTGAGATACTTGTTGG - Intronic
1014575355 6:123063112-123063134 TTTTATTTGGATATTCTACTAGG + Intronic
1017176782 6:151512459-151512481 TTTTAAAATGATATACTACTGGG - Intronic
1017643968 6:156521827-156521849 TTTTATTTTTATTTACTAGCTGG - Intergenic
1018299024 6:162380052-162380074 TTCCAGTATAATATACTAGTGGG - Intronic
1020382391 7:7561334-7561356 TTTTTTTTTCATATACTTGTTGG - Intergenic
1021343511 7:19492651-19492673 TTTTACTGTGATAAACCAGTAGG + Intergenic
1023005554 7:35862130-35862152 TCTTAGTTTGTTATACTTCTGGG - Intronic
1023580289 7:41675018-41675040 TTTTATTTTAATATACTTGAGGG - Intergenic
1024317435 7:48035069-48035091 TTTTATTTTTGTATACTGGTGGG + Intergenic
1025217967 7:57076065-57076087 TCTTAGTTTGTTATACTTCTGGG + Intergenic
1025628884 7:63249703-63249725 TCTTAGTTTGTTATACTTCTGGG + Intergenic
1025653379 7:63494391-63494413 TCTTAGTTTGTTATACTTCTGGG - Intergenic
1027381513 7:77614917-77614939 TTTTAGTTTGATATACTAGTTGG + Intronic
1027811548 7:82907152-82907174 TATTAGTTTGATAAATTAGGTGG + Intronic
1029834274 7:103292765-103292787 TTTTATTTTGAGATAATTGTAGG + Intergenic
1030777975 7:113559808-113559830 TTTAAGTATTATATATTAGTAGG + Intergenic
1030925533 7:115449076-115449098 TTTGAGTTTCATATATTTGTAGG + Intergenic
1032807646 7:135373118-135373140 TTATACTTTTATATACAAGTAGG - Intronic
1034861957 7:154603830-154603852 TTTTATTTTCATAGATTAGTTGG - Intronic
1036536105 8:9654333-9654355 TTTTAGTTAGCAGTACTAGTAGG - Intronic
1037149862 8:15623782-15623804 TTTTATTTTGAAATAATTGTAGG + Intronic
1037328727 8:17722046-17722068 TCTTAGTTTGATTTGCTAGCTGG - Intronic
1037559681 8:20061804-20061826 TTTTACTTTTATTTACTTGTTGG + Intergenic
1042792034 8:72618402-72618424 TTGTAGTTTTATCAACTAGTTGG - Intronic
1043443303 8:80295779-80295801 TTTGAATTTAATATAGTAGTTGG + Intergenic
1044039469 8:87348634-87348656 TTTTGGTATGTTAGACTAGTAGG + Intronic
1044046484 8:87441077-87441099 TTTTTTTTTCATATACTTGTTGG + Intronic
1044391095 8:91652043-91652065 TTTTATTTTGGTATATTACTTGG - Intergenic
1044555091 8:93554485-93554507 TTTGAGTTTGATCAAGTAGTTGG + Intergenic
1045521650 8:102908285-102908307 TTTTATTTTTATATACCTGTTGG - Intronic
1045593890 8:103630880-103630902 TTTTATTTTAATATGCTTGTTGG + Intronic
1046204745 8:110978753-110978775 TTATGGTTTGTTATACAAGTGGG - Intergenic
1046441796 8:114265569-114265591 TTTTTGTTTTATATACTTGTGGG + Intergenic
1046578808 8:116066544-116066566 ATTTAGTTTGCTTTAATAGTAGG - Intergenic
1046645220 8:116778396-116778418 TTTTATGTTGATATAATATTGGG - Intronic
1050935413 9:11388727-11388749 TTTTTTTTTCATATACTTGTTGG - Intergenic
1054909999 9:70445847-70445869 TAATAGTTAGAGATACTAGTAGG + Intergenic
1057735085 9:97650229-97650251 ATTTAGTTTCATATAATAATTGG + Intronic
1058044693 9:100344434-100344456 TTGTATTTAGATAGACTAGTAGG - Intronic
1058268159 9:102933647-102933669 TTTTATTTAGATATAATTGTAGG + Intergenic
1061111427 9:128574293-128574315 TTTTAGTATTATATAATAATAGG - Intronic
1186744720 X:12555870-12555892 GTTTAATTTGATATAAAAGTGGG - Intronic
1187934604 X:24323350-24323372 TTTTAGTTTGATCAAGTAATAGG - Intergenic
1188742078 X:33797087-33797109 CTTTAGTTTGATAGATCAGTAGG + Intergenic
1188913201 X:35876323-35876345 TTTTATTTTGATATATTATTTGG + Intergenic
1189709853 X:43798189-43798211 TCATAGGTTGATATTCTAGTGGG - Intronic
1189831856 X:44982216-44982238 TTTCAGTTTGAAAAACTAGTTGG + Intronic
1191962236 X:66716195-66716217 TTTAAGTTTGAAATACTATAAGG - Intergenic
1192126133 X:68502618-68502640 GTTTAGTTTGAGATACTGGCAGG + Intronic
1193165250 X:78273197-78273219 TTTTAGTTTGATTGTCTTGTGGG + Exonic
1193704088 X:84799546-84799568 TATTAATTTGATATACAACTAGG + Intergenic
1194667475 X:96691338-96691360 TATTAGCTTGATATCCAAGTGGG + Intronic
1195151929 X:102080617-102080639 TTTCATTTTGATGTTCTAGTGGG - Intergenic
1196990968 X:121328302-121328324 TTTTAGTTTGATCATATAGTTGG - Intergenic
1198303827 X:135360014-135360036 TTGTTCTTTGATATACTAGTGGG + Intronic
1198749097 X:139921030-139921052 TTTTAGCTTGAGCTACTAGGAGG + Intronic
1198993921 X:142550674-142550696 TTGTAGTTTGATATAATATTAGG - Intergenic
1199340701 X:146674192-146674214 TTTTTGTTTTATATTCTAGTTGG - Intergenic
1201182039 Y:11358280-11358302 TGTTGGGTTGATATGCTAGTTGG - Intergenic