ID: 1027391652

View in Genome Browser
Species Human (GRCh38)
Location 7:77709709-77709731
Sequence AACCAAATGCTGAAACTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027391652_1027391656 9 Left 1027391652 7:77709709-77709731 CCACTAAGTTTCAGCATTTGGTT 0: 1
1: 0
2: 0
3: 13
4: 207
Right 1027391656 7:77709741-77709763 GCCCTTTGTACTCTTCTTTCTGG 0: 1
1: 0
2: 1
3: 17
4: 201
1027391652_1027391659 28 Left 1027391652 7:77709709-77709731 CCACTAAGTTTCAGCATTTGGTT 0: 1
1: 0
2: 0
3: 13
4: 207
Right 1027391659 7:77709760-77709782 CTGGCTTTTGCTAATTGCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027391652 Original CRISPR AACCAAATGCTGAAACTTAG TGG (reversed) Intronic