ID: 1027391652 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:77709709-77709731 |
Sequence | AACCAAATGCTGAAACTTAG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 221 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 13, 4: 207} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1027391652_1027391656 | 9 | Left | 1027391652 | 7:77709709-77709731 | CCACTAAGTTTCAGCATTTGGTT | 0: 1 1: 0 2: 0 3: 13 4: 207 |
||
Right | 1027391656 | 7:77709741-77709763 | GCCCTTTGTACTCTTCTTTCTGG | 0: 1 1: 0 2: 1 3: 17 4: 201 |
||||
1027391652_1027391659 | 28 | Left | 1027391652 | 7:77709709-77709731 | CCACTAAGTTTCAGCATTTGGTT | 0: 1 1: 0 2: 0 3: 13 4: 207 |
||
Right | 1027391659 | 7:77709760-77709782 | CTGGCTTTTGCTAATTGCCCTGG | 0: 1 1: 0 2: 1 3: 18 4: 280 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1027391652 | Original CRISPR | AACCAAATGCTGAAACTTAG TGG (reversed) | Intronic | ||