ID: 1027391652

View in Genome Browser
Species Human (GRCh38)
Location 7:77709709-77709731
Sequence AACCAAATGCTGAAACTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027391652_1027391656 9 Left 1027391652 7:77709709-77709731 CCACTAAGTTTCAGCATTTGGTT 0: 1
1: 0
2: 0
3: 13
4: 207
Right 1027391656 7:77709741-77709763 GCCCTTTGTACTCTTCTTTCTGG 0: 1
1: 0
2: 1
3: 17
4: 201
1027391652_1027391659 28 Left 1027391652 7:77709709-77709731 CCACTAAGTTTCAGCATTTGGTT 0: 1
1: 0
2: 0
3: 13
4: 207
Right 1027391659 7:77709760-77709782 CTGGCTTTTGCTAATTGCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027391652 Original CRISPR AACCAAATGCTGAAACTTAG TGG (reversed) Intronic
902929109 1:19717798-19717820 AACCAAATGCTGCATCTCAAGGG - Intronic
903341005 1:22654257-22654279 AACCCAAGGCTGAAACTCGGTGG + Intronic
904341982 1:29841531-29841553 AGCCAAAAGCTAAAACTTTGAGG - Intergenic
906666288 1:47624418-47624440 AACCTCATGCTGGAACTCAGAGG - Intergenic
907592399 1:55687552-55687574 AACGAAATGTCGAAACCTAGAGG - Intergenic
908478289 1:64510583-64510605 AACAAGAGGCAGAAACTTAGTGG - Intronic
909696153 1:78470171-78470193 AAGCAAAGGCTGAAAGTCAGGGG + Intronic
909765860 1:79355038-79355060 AAACAACTGCTGAGAGTTAGTGG - Intergenic
911275999 1:95859216-95859238 AACCAAAAGCTGATTCTTGGAGG - Intergenic
911442413 1:97943879-97943901 AACTAAATTCTCAAACTTACTGG - Intergenic
911752248 1:101508845-101508867 AAGAATATTCTGAAACTTAGAGG - Intergenic
918193139 1:182195746-182195768 AACCAAATGCAGGAACTCAGTGG - Intergenic
919136438 1:193513580-193513602 AAACAAATTTTAAAACTTAGTGG - Intergenic
920876028 1:209836829-209836851 TTCCAACTTCTGAAACTTAGAGG - Exonic
924170326 1:241332720-241332742 AACCAAAAGCAGAAACTTACTGG + Intronic
924350977 1:243114420-243114442 AACCAAATGCAAACACTTCGGGG + Intergenic
924634113 1:245768593-245768615 ATTCAGATGCTGAAACTTAATGG + Intronic
1063359114 10:5434582-5434604 ACACAAATGCTGATACTTTGTGG + Intronic
1067974096 10:51004567-51004589 AATCAAATGTGCAAACTTAGTGG + Intronic
1068513695 10:57998980-57999002 AATAAAATTCTGAAATTTAGTGG + Intergenic
1068741546 10:60478743-60478765 AACCAAATGGAGCATCTTAGTGG + Intronic
1069046605 10:63750016-63750038 TACCAAGTGCTGAAACTGATAGG + Intergenic
1069083303 10:64111484-64111506 ATCCACATGTTGAAACTTAAGGG + Intergenic
1070495416 10:77016996-77017018 AAGCAAATGCTGTCAGTTAGGGG - Intronic
1070640035 10:78161675-78161697 AACCAAATGCTGTAACTGGATGG + Intergenic
1071677023 10:87664244-87664266 AAACAAATGCAGAAATATAGAGG + Intronic
1073915002 10:108392549-108392571 AACGAAATGCAGAAACCTAAAGG + Intergenic
1077235186 11:1478616-1478638 AACCAAATGCTGAGAACTGGGGG - Intronic
1078520374 11:12058034-12058056 TGACAAACGCTGAAACTTAGTGG + Intergenic
1079559790 11:21807533-21807555 CAACATATGCTGAAACTCAGTGG - Intergenic
1079688434 11:23392059-23392081 AACCAGAAGCTGAAAGTTACTGG + Intergenic
1080903639 11:36519516-36519538 AACCTAATGTTCAACCTTAGAGG - Intronic
1081014927 11:37865183-37865205 AAAGAAATGATGAAACTTACTGG + Intergenic
1081884092 11:46479848-46479870 AACAACAAGCAGAAACTTAGTGG + Intronic
1082205659 11:49430952-49430974 AAACTAATGATGAAACTTGGAGG + Intergenic
1085580749 11:77648079-77648101 TGCCAAAAGCTGCAACTTAGGGG + Intergenic
1086725198 11:90173790-90173812 AATCAAATACTGGAAATTAGGGG - Intronic
1087187693 11:95218810-95218832 AACAAAATGCAAAAAATTAGCGG - Intronic
1087510694 11:99088708-99088730 AGCCAAATGCTGAAGACTAGTGG + Intronic
1087748498 11:101978368-101978390 AACGAATTGCTGAAACTAAGCGG + Exonic
1087992792 11:104766611-104766633 GACCAAATGCAAATACTTAGTGG - Intergenic
1088935590 11:114396748-114396770 AAACAAAAGCTGCACCTTAGTGG + Intronic
1090214021 11:124944354-124944376 AACCAGATGCAGAATCTTGGAGG - Intergenic
1091273785 11:134335971-134335993 AAGCAAAAGCTAAAACTGAGTGG - Intronic
1091542001 12:1470394-1470416 AACCTAATGCTGAAACTGTCAGG - Intronic
1092336062 12:7634747-7634769 AAACAGATGCTGATACTTTGTGG + Intergenic
1093161312 12:15750426-15750448 ACCCAAATGCTCAAATTGAGTGG - Intronic
1096276448 12:50212666-50212688 AACCAAATGCTAATGCTTTGGGG + Intronic
1099047108 12:77735294-77735316 AACCAAATGTTTATACTCAGAGG - Intergenic
1099602795 12:84763003-84763025 AACAAGATGCTGAAAATAAGTGG + Intergenic
1103832746 12:123793294-123793316 AACCTAATGCTGAAAATAGGGGG - Intronic
1106004194 13:25753242-25753264 AACCAAGTGCTAACACTTACAGG + Intronic
1106488296 13:30191969-30191991 GACCAAAGTCTGCAACTTAGAGG - Intergenic
1108487519 13:50941925-50941947 AACCATAGGCTGAAACAGAGAGG + Intronic
1108709837 13:53022135-53022157 AACCAACTGCTGAAACCTCGAGG - Intergenic
1109416072 13:62043117-62043139 AACCAACTGTTGAAACTAATAGG + Intergenic
1110154995 13:72305883-72305905 AACAGAATGCTGAAAATTAATGG - Intergenic
1110910347 13:80953541-80953563 AACCAAATACTGCATGTTAGTGG + Intergenic
1111598300 13:90438750-90438772 CACAAACTGCTGGAACTTAGGGG - Intergenic
1111663770 13:91242719-91242741 AACCTAAGGCTGAAACTAAAAGG - Intergenic
1112074710 13:95898960-95898982 ACCCATGTGTTGAAACTTAGTGG + Intronic
1112412869 13:99178991-99179013 AACAAAACCTTGAAACTTAGAGG - Intergenic
1114072376 14:19123758-19123780 AATCAAATGCTGCATCTTAAAGG - Intergenic
1114089883 14:19276215-19276237 AATCAAATGCTGCATCTTAAAGG + Intergenic
1115332802 14:32215656-32215678 ATTCAAATGTTGAAACTTAATGG + Intergenic
1117102859 14:52368327-52368349 AGCCAAATGCAGAATTTTAGAGG + Intergenic
1118236376 14:64008790-64008812 AACCACATGCGGAAACAAAGCGG - Intronic
1119969378 14:78952343-78952365 AACCAGAAGCTGAAATTTTGTGG + Intronic
1120839855 14:89076010-89076032 AAGCAAATGTTCAAACCTAGAGG + Intergenic
1121148734 14:91610389-91610411 AAAGAAATGCTGAAACTGAATGG + Intronic
1126737744 15:51749268-51749290 AACCTAATGTTAAAACTTAATGG - Intronic
1127682531 15:61311492-61311514 CAGCAAATGCTGAAACTAAAGGG - Intergenic
1129951367 15:79594685-79594707 AACCCATTTCTGAAACTTACTGG + Intergenic
1131546969 15:93323770-93323792 AAACACATGCTGAAATTTTGGGG - Intergenic
1131704268 15:94975399-94975421 AACTAAATGGTGGAACTTAAGGG - Intergenic
1134305142 16:13025238-13025260 AAACAAATGTTGAAAATTACTGG - Intronic
1134441042 16:14299906-14299928 AACAAAAGACTGAAGCTTAGAGG - Intergenic
1137991919 16:53165939-53165961 AAACAAATTCTGAAAAATAGAGG - Intronic
1138719444 16:59061878-59061900 AACCAAATAATGAAACATAATGG + Intergenic
1143069339 17:4277344-4277366 AACAAATTACTAAAACTTAGTGG - Intronic
1144342413 17:14320825-14320847 AACTGAATGCTGGAACTGAGCGG - Intronic
1146060317 17:29601954-29601976 AATCAAATGCTGAAAACTAGTGG - Intronic
1146532399 17:33620369-33620391 AACGAATTGCTGAAATTTGGTGG - Intronic
1148198888 17:45734778-45734800 AACCAATTATTGAAACTCAGAGG + Intergenic
1154984010 18:21531094-21531116 AACCTAAAACTGAAATTTAGGGG + Intronic
1156123467 18:33874077-33874099 ATACAAAATCTGAAACTTAGGGG + Intronic
1156752807 18:40480806-40480828 AAACAAAAGCTCAAACTCAGTGG + Intergenic
1158115332 18:53989412-53989434 AACCAAATACCGAAACTCAATGG + Intergenic
1159339418 18:67116571-67116593 AACAAAATGTTGAAAAGTAGGGG - Intergenic
1159500437 18:69262086-69262108 AATAAAATGCTTAAATTTAGTGG - Intergenic
925378276 2:3404587-3404609 TAACAAATGCTGTAACTTGGGGG + Intronic
929943679 2:46354112-46354134 AACCCAAAGCTTAAATTTAGAGG + Intronic
930180095 2:48347021-48347043 AATCAAATGCTGATAGTTATAGG - Intronic
931915704 2:66952710-66952732 AACCAAATGGTAAATCTCAGAGG - Intergenic
935014815 2:99172003-99172025 CACCACATACTGAAACTCAGTGG + Intronic
935097071 2:99955077-99955099 ACACAAATCCTGAAACTTTGTGG + Intronic
938340586 2:130533482-130533504 CCCCAAATGGTGAAACTTGGAGG - Intergenic
938349244 2:130587237-130587259 CCCCAAATGGTGAAACTTGGAGG + Intergenic
945065736 2:205946402-205946424 AGCCACATCCTGTAACTTAGGGG - Intergenic
945658000 2:212649030-212649052 ATTCAAATGTTGAAACTTAATGG - Intergenic
946070095 2:217027066-217027088 AACCACATGCTCAGACTTGGGGG - Intergenic
947351628 2:229252397-229252419 AAGCAGTTGATGAAACTTAGAGG - Intronic
1169700590 20:8442505-8442527 ATTCAGATGCTGAAACTTAATGG - Intronic
1170550977 20:17475824-17475846 AACCAAAGACTGTAACTGAGTGG - Intronic
1171308196 20:24123964-24123986 TGCCACATGCTGAAAATTAGGGG + Intergenic
1176162514 20:63654943-63654965 AACCCAAGGCTGAAACCAAGTGG - Intergenic
1178733417 21:35126884-35126906 AACCAATTCCTCAAACTTTGGGG - Intronic
1180490821 22:15846132-15846154 AATCAAATGCTGCATCTTAAAGG - Intergenic
1182003452 22:26939833-26939855 AAGCAGAAGCTGAAGCTTAGAGG + Intergenic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
949511334 3:4769763-4769785 AACCAAATGCTGAGAGACAGAGG + Intronic
950201728 3:11049197-11049219 AACCACAGACTGAGACTTAGGGG + Intergenic
952546355 3:34423909-34423931 CTGCAAATGCTGAAACTTTGGGG + Intergenic
952620503 3:35334308-35334330 AACAACATACTGAAACTTACGGG - Intergenic
955062031 3:55501161-55501183 AATCAAATGCAGAAACTGATTGG + Intergenic
956187466 3:66576329-66576351 AACCAAAAGCTTACACTTTGAGG - Intergenic
957158360 3:76575715-76575737 AACCAAATGCTAATATGTAGGGG + Intronic
959707578 3:109352618-109352640 ATACAAATGCTCAAACTGAGTGG - Intergenic
959758927 3:109934294-109934316 AACCAATTCCTGTAACATAGAGG + Intergenic
960632681 3:119748751-119748773 AACTAAATGCTTATCCTTAGGGG - Intronic
962729839 3:138271312-138271334 AACCAGAAACTGAAACTTGGGGG - Intronic
963073050 3:141320738-141320760 AAACAACTGAAGAAACTTAGAGG + Intergenic
965508310 3:169540448-169540470 AAGCAAATGATCAAAGTTAGGGG - Intronic
965596171 3:170413573-170413595 GACAAAATCCTGAAACTTACAGG + Intergenic
966775369 3:183538835-183538857 ATCCATATGATAAAACTTAGGGG - Intronic
966822947 3:183939551-183939573 AACTAAATGTTGACCCTTAGAGG - Intronic
972099906 4:35401929-35401951 AACCAAAAGCCAAAACTGAGTGG + Intergenic
974696794 4:65386957-65386979 AAAAAAAGGCTGAAACTTATAGG + Intronic
974736663 4:65944265-65944287 AACGAAATGTTGAAATTTATGGG + Intergenic
975054747 4:69916033-69916055 AGGCAAATGGTGAAACTTTGAGG + Intergenic
975740418 4:77424175-77424197 ATTCACATGCTGAAACTTAATGG - Intronic
976577462 4:86690815-86690837 AACTAAATGCTAAACCTTAAAGG - Intronic
976621402 4:87131502-87131524 AAACAAAGGCTTAAACTGAGAGG - Intronic
976691705 4:87875214-87875236 AAACAAAAGCTGTAATTTAGTGG + Intergenic
977280491 4:95033697-95033719 AACAGAATGGTGAAACTTAGAGG + Intronic
978889914 4:113813154-113813176 CTCCAAATGCTGTAACTTTGGGG - Intergenic
979250961 4:118566138-118566160 AACCAAATGCAAACACTTCGGGG - Intergenic
980499580 4:133631008-133631030 ACCCAAATGGTTGAACTTAGGGG + Intergenic
983770317 4:171540914-171540936 AACCAAATGTTGAAAAATAAAGG + Intergenic
983857574 4:172664346-172664368 AATCACAAGCTGAAACTTAAAGG - Intronic
984307377 4:178011476-178011498 AAACAAATGACAAAACTTAGAGG - Intergenic
984762146 4:183371890-183371912 AATCAAATGCTGAAAACCAGAGG + Intergenic
986260701 5:6143589-6143611 AACCAGAAGCTGAAACTAATAGG + Intergenic
986779525 5:11051645-11051667 AACCTAATTCTAAAAATTAGAGG - Intronic
987629320 5:20447268-20447290 ATTCAAATGTTGAAACTTAATGG + Intronic
988446380 5:31290433-31290455 AACCAGATGATTAAACTTAATGG + Intronic
989036834 5:37182442-37182464 AACCAAAACCTGAAACTGAAAGG + Intronic
989992108 5:50779285-50779307 AAAAAAATCCTAAAACTTAGTGG + Intronic
990781158 5:59365017-59365039 AACCAAAAACTGAAACTCAAGGG + Intronic
991361234 5:65822799-65822821 AACCTAATCCTGAAACCTGGGGG + Exonic
992816843 5:80450192-80450214 CACTAAATGCTGAAATGTAGTGG - Intronic
992993319 5:82307578-82307600 AACCAGCTGCTGAGACCTAGTGG + Intronic
994211503 5:97091860-97091882 AACCAAATTCTGAACATTAGAGG + Exonic
997076281 5:130681984-130682006 AACTAAATGCCTAAACATAGGGG + Intergenic
997415983 5:133729066-133729088 AGCCACATGCTGAAGCTGAGAGG + Intergenic
997918958 5:137958945-137958967 AAACAAATGCTGAACTTCAGTGG - Intronic
1000613635 5:163403441-163403463 CACCAAATGCTAAAACTGAATGG - Intergenic
1000615394 5:163420200-163420222 CACCAAATACTGAAAATTACTGG - Intergenic
1000624151 5:163520212-163520234 AACAAAATGCTTTAATTTAGTGG - Intergenic
1001631085 5:173175890-173175912 ATCCAAATCCTGAAACTTGCAGG + Intergenic
1007592885 6:43033876-43033898 AACCAACAGCTGAAGCTCAGAGG - Intronic
1009030793 6:58055940-58055962 AAACAATTGCAGATACTTAGAGG + Intergenic
1009206650 6:60810401-60810423 AAACAATTGCAGATACTTAGAGG + Intergenic
1013391909 6:109693774-109693796 AACCATTTGCTGAAACAAAGAGG - Intronic
1013447066 6:110240667-110240689 AGCCAATTGCTGATACTTTGTGG - Intronic
1014719989 6:124904485-124904507 AACCAAATTTTAAAACTCAGTGG + Intergenic
1014780019 6:125554040-125554062 AACCAAATTCTAAAACTAAGAGG - Intergenic
1016771188 6:147853216-147853238 ATCCAATTACTGAGACTTAGAGG - Intergenic
1017193259 6:151675712-151675734 AAGCAAATGATCAAACTTAGGGG - Intronic
1018198520 6:161375511-161375533 TACAAAATGGTGAAACTTGGGGG - Intronic
1019878768 7:3840230-3840252 AACCAAAAGTTGAAACAGAGTGG + Intronic
1021106642 7:16645889-16645911 AACCAAATGCAGAAAGCTGGAGG + Intergenic
1021253726 7:18363605-18363627 AAGCAGATGGAGAAACTTAGTGG - Intronic
1021459006 7:20864435-20864457 AAGCATATGGTAAAACTTAGGGG + Intergenic
1021832779 7:24633477-24633499 AACAAAATACTGAAACATCGGGG - Intronic
1025721304 7:64017564-64017586 AAGCAGATGCTCAAACTTTGTGG + Intergenic
1027391652 7:77709709-77709731 AACCAAATGCTGAAACTTAGTGG - Intronic
1027899202 7:84087848-84087870 AACAAAATGCAAAAACATAGAGG - Intronic
1028454793 7:91027413-91027435 AAGCAAGTCCTGAAACTTTGGGG - Intronic
1028625368 7:92871235-92871257 CACCCAATGCTGAAACCTAAGGG - Intergenic
1028677054 7:93477192-93477214 ACCCAGATGCTGAAACTAAATGG - Intronic
1030551253 7:110963109-110963131 AAGCAAATGCAGAAACTAAGAGG - Intronic
1030686633 7:112493752-112493774 AAGAAAATGCTGAAAGTCAGGGG - Intergenic
1030755242 7:113279795-113279817 ACCCAAATGATGAAACTCACTGG + Intergenic
1031180940 7:118414077-118414099 AACCAAATGCTAAAACTACTGGG + Intergenic
1032152679 7:129443627-129443649 ACACAACTCCTGAAACTTAGAGG - Intronic
1032640290 7:133758944-133758966 AAAAAAATGCTGAAATTTTGAGG + Intronic
1032787967 7:135215971-135215993 AACCAAATGTTCAACATTAGAGG + Intergenic
1033081097 7:138298159-138298181 AAGGAAATGCTGAAACTTCCAGG - Intergenic
1033387941 7:140897075-140897097 AACCAAATACCTAGACTTAGAGG + Intronic
1034996835 7:155582671-155582693 CACCAGATGCTGAAGCTTTGTGG + Intergenic
1035643879 8:1203583-1203605 AACGAGAAGCTGAAACTTAAAGG - Intergenic
1035951010 8:4020904-4020926 CAGCAATTGCTGAAACTTAAAGG + Intronic
1037054542 8:14423049-14423071 AAACAAATGGTGAAAGTTAGTGG - Intronic
1037091423 8:14924225-14924247 TACTAAATGCTTAAAGTTAGAGG - Intronic
1038418040 8:27411990-27412012 AGCCAAATGAAGAAACATAGAGG + Intronic
1038956387 8:32472810-32472832 AAAGAAATGCTGAGACTAAGTGG + Intronic
1041736109 8:61112728-61112750 AACCCAATCCTGAAGCTTACAGG - Intronic
1042306548 8:67339459-67339481 AAGAAACTCCTGAAACTTAGAGG + Intronic
1042816516 8:72883247-72883269 AACTATGTGGTGAAACTTAGAGG + Intronic
1045850066 8:106685475-106685497 AACAAAATGTTGAAAGTTAAGGG + Intronic
1047013323 8:120695991-120696013 GAACAAATGCAGAAATTTAGGGG + Intronic
1047134493 8:122060693-122060715 ATGCAAATGCTGAAAATTACAGG + Intergenic
1047596316 8:126381178-126381200 AATGAGATGCTGAGACTTAGAGG - Intergenic
1047806338 8:128364771-128364793 ATTCAAATGTTGAAACTTAATGG + Intergenic
1048296256 8:133216608-133216630 AGCCAAATGATGTAACTCAGAGG - Intronic
1049916759 9:325049-325071 AACCAAATGCTGTATGTTAGTGG - Intronic
1050638020 9:7633531-7633553 AACCAAAAGCTGATTCTTTGGGG + Intergenic
1053129287 9:35605881-35605903 AACCAGAGGCTGAAACTAGGGGG + Intronic
1056422279 9:86439776-86439798 AATCAAATGCTGGATCTTTGGGG + Intergenic
1060130105 9:121087906-121087928 AACCAAAGGAAGAAACTTTGAGG + Intronic
1186779907 X:12902075-12902097 TACCAAATGCTGAAAATATGTGG - Intergenic
1186850190 X:13572110-13572132 AGCCAAATTCTGAAGCTTAAGGG - Intronic
1190450654 X:50577389-50577411 AGCCAATTGCTGAAAGTAAGAGG + Intergenic
1191924381 X:66294007-66294029 AACAAAATGTTGAAAAGTAGGGG - Intergenic
1192609050 X:72549278-72549300 AAACAAATACTGAGACTTATGGG - Intronic
1192766086 X:74140811-74140833 AACCAAATGGTGACTCTCAGTGG + Intergenic
1192824236 X:74678402-74678424 ATCCAGGTGCTGAAACTTAATGG - Intergenic
1193051430 X:77103546-77103568 TACCCAATGCTGACACTTGGAGG - Intergenic
1198554211 X:137775628-137775650 AACGAATTACTCAAACTTAGTGG + Intergenic
1201897900 Y:19013189-19013211 AACTAGATGGTGAAACTTAGTGG - Intergenic