ID: 1027391657

View in Genome Browser
Species Human (GRCh38)
Location 7:77709742-77709764
Sequence GCCAGAAAGAAGAGTACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027391657_1027391659 -5 Left 1027391657 7:77709742-77709764 CCCTTTGTACTCTTCTTTCTGGC No data
Right 1027391659 7:77709760-77709782 CTGGCTTTTGCTAATTGCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027391657 Original CRISPR GCCAGAAAGAAGAGTACAAA GGG (reversed) Intronic