ID: 1027391659

View in Genome Browser
Species Human (GRCh38)
Location 7:77709760-77709782
Sequence CTGGCTTTTGCTAATTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 280}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027391658_1027391659 -6 Left 1027391658 7:77709743-77709765 CCTTTGTACTCTTCTTTCTGGCT No data
Right 1027391659 7:77709760-77709782 CTGGCTTTTGCTAATTGCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 280
1027391657_1027391659 -5 Left 1027391657 7:77709742-77709764 CCCTTTGTACTCTTCTTTCTGGC No data
Right 1027391659 7:77709760-77709782 CTGGCTTTTGCTAATTGCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 280
1027391652_1027391659 28 Left 1027391652 7:77709709-77709731 CCACTAAGTTTCAGCATTTGGTT 0: 1
1: 0
2: 0
3: 13
4: 207
Right 1027391659 7:77709760-77709782 CTGGCTTTTGCTAATTGCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027391659 Original CRISPR CTGGCTTTTGCTAATTGCCC TGG Intronic