ID: 1027399651

View in Genome Browser
Species Human (GRCh38)
Location 7:77794379-77794401
Sequence CAGTTTAAAGAGGCTGTTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027399649_1027399651 -2 Left 1027399649 7:77794358-77794380 CCAAGGACATTCTCATTTAAACA 0: 1
1: 0
2: 4
3: 38
4: 335
Right 1027399651 7:77794379-77794401 CAGTTTAAAGAGGCTGTTGCAGG 0: 1
1: 0
2: 1
3: 11
4: 181
1027399647_1027399651 21 Left 1027399647 7:77794335-77794357 CCAGGTGAGTAGTACTCTCTGAG 0: 1
1: 0
2: 0
3: 13
4: 103
Right 1027399651 7:77794379-77794401 CAGTTTAAAGAGGCTGTTGCAGG 0: 1
1: 0
2: 1
3: 11
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027399651 Original CRISPR CAGTTTAAAGAGGCTGTTGC AGG Exonic
901439751 1:9270657-9270679 CAGTGCTAAGAGGCTGTTGCAGG + Exonic
902309772 1:15573010-15573032 CACTTTAAGGAGGCTGAGGCGGG + Exonic
903999184 1:27328806-27328828 CAGTTTAAAAAAGCAGTTACAGG - Intronic
905348703 1:37329558-37329580 CAGTTTAAAAAGGCTGATTTAGG - Intergenic
906301353 1:44684180-44684202 CAATTTCAAGAGTCAGTTGCTGG - Intronic
907923538 1:58934892-58934914 CAGTTTGAATAGGCTTTTGTTGG + Intergenic
910099764 1:83563499-83563521 CAGATCACAGAGGCTGTTGTAGG + Intergenic
910552906 1:88497191-88497213 CTATTAAAAGAGGCTGTTTCAGG - Intergenic
910820350 1:91338559-91338581 CAGTGTGAGGAGGCTGTTGGTGG - Intronic
912839134 1:113023529-113023551 TAGTCTCAAGAGGCTGATGCAGG - Intergenic
914447662 1:147763583-147763605 AAGTTGAAAGAGGATGTTGAAGG - Intronic
917042362 1:170819872-170819894 AAGCTTTAAGAGGTTGTTGCGGG + Intergenic
919122506 1:193358653-193358675 CTTTTTAAAGAGGCTGTCACAGG + Intergenic
1062841483 10:676520-676542 CAGTTCAAAGAGATTTTTGCTGG - Intronic
1067401470 10:45978103-45978125 CACTTTTAAGAGGCTGAGGCGGG + Intronic
1067869821 10:49947680-49947702 CACTTTTAAGAGGCTGAGGCGGG + Intronic
1068308271 10:55243720-55243742 CACTTTAGAGAGACTGTTTCTGG - Intronic
1073159375 10:101376641-101376663 TATTTTAAAGATGCTGTGGCTGG + Intronic
1075140528 10:119830393-119830415 CAGTTGTACGAGGCTGTTACTGG + Exonic
1078272856 11:9812612-9812634 CAGTTTTAAGAAGCTGATGAGGG - Exonic
1080196560 11:29616749-29616771 AAGTTTGAACAGGCAGTTGCTGG + Intergenic
1081510894 11:43772196-43772218 CATTTTAAAGATCCTGTTGATGG + Intronic
1082218430 11:49602808-49602830 GATTTTAAAGAGGCTTGTGCAGG + Intergenic
1082761566 11:57131663-57131685 CTTTTGAAAGAGGCTGTTCCAGG - Intergenic
1086631147 11:89021312-89021334 GATTTTAAAGAGGCTTGTGCAGG - Intronic
1087499976 11:98938290-98938312 AAATTTAAAGTGGGTGTTGCCGG + Intergenic
1087843186 11:102941138-102941160 CTTTTTAAAAAGGGTGTTGCTGG + Intergenic
1088143237 11:106643959-106643981 CATTTTAAAGACTCAGTTGCAGG + Intergenic
1088886486 11:114011551-114011573 AAGGGTTAAGAGGCTGTTGCAGG - Intergenic
1091494916 12:964208-964230 AAGTTTTAAGAGGATTTTGCTGG + Intronic
1091694276 12:2617472-2617494 GAGCTGACAGAGGCTGTTGCTGG + Intronic
1093135311 12:15442603-15442625 CAGTTCCAAGAGGCTTTTGGTGG - Intronic
1094005718 12:25748493-25748515 CAGATTGAAGAGGCTCCTGCTGG - Intergenic
1096055944 12:48652057-48652079 CAGATTTAAGAGGCTGAAGCAGG + Intergenic
1101435935 12:104664603-104664625 CATTTTACAGTGACTGTTGCCGG - Intronic
1102182160 12:110920764-110920786 AAGGTTAAAGAGGCAGTAGCTGG + Intergenic
1102315919 12:111887424-111887446 CAGTTTTGAGAGGCTGAGGCAGG + Intronic
1102787445 12:115616367-115616389 CAGGTTCAAGAGGCTGCTGCAGG - Intergenic
1103805080 12:123566058-123566080 AAGTTTAGATAGGCAGTTGCTGG - Intergenic
1104442428 12:128805006-128805028 CTGTTAAAAGAGGCTGATGTTGG - Intronic
1107746155 13:43511783-43511805 CAGTTTGAAGCAGCAGTTGCTGG - Intronic
1108207403 13:48104636-48104658 CAGAGTAAAGATGATGTTGCAGG + Intergenic
1110641171 13:77826080-77826102 CAATGTACAGAGGCTGTTCCTGG - Intergenic
1110766136 13:79281366-79281388 CAGTTAGAAGAGGATGTTGATGG - Intergenic
1110787559 13:79548589-79548611 CAGTGTAAAGAGTCAGTGGCGGG + Intronic
1111119058 13:83822657-83822679 AAGGTTGAAGAGGCGGTTGCTGG - Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1113281170 13:108789500-108789522 GATTTTGAAGAGGCTGGTGCAGG - Intronic
1115608422 14:35029093-35029115 CAGTTTCAACAGGGTGCTGCTGG + Exonic
1118570310 14:67188280-67188302 CATTTTAAAGACGCTTTTGAAGG + Intergenic
1120815939 14:88858206-88858228 CACTTTAAGGAGGCTGAGGCGGG - Intronic
1121194867 14:92061326-92061348 CTGTTTGAAAAGGCTGCTGCAGG - Exonic
1121489997 14:94351202-94351224 CAGCTTATAGAGGCTGAGGCAGG + Intergenic
1124504858 15:30263937-30263959 CAGTGGAAAGGGGATGTTGCAGG - Intergenic
1124738694 15:32274698-32274720 CAGTGGAAAGGGGATGTTGCAGG + Intergenic
1126130508 15:45336864-45336886 CACTTTGAAGAGGCTGAGGCAGG + Intergenic
1126212847 15:46119498-46119520 CAGATTAAAGAGACTGATGAAGG + Intergenic
1127856464 15:62957705-62957727 CAATTGACAGAGGCAGTTGCTGG - Intergenic
1131718163 15:95136328-95136350 CAGTATAAAGAACCTGTTCCGGG + Intergenic
1133802351 16:9093260-9093282 CAGTGTATAGAGGCTGCTGAAGG + Intronic
1134139768 16:11707834-11707856 CAGTTTTGAGAGGCTGAGGCAGG + Intronic
1134377564 16:13691895-13691917 CAGTTTTAGGAGGCTTTTGGTGG - Intergenic
1135792736 16:25412424-25412446 CAGTTGAAAGAGGTTGTGGAGGG - Intergenic
1136163660 16:28438117-28438139 CAGTTTAGGGAGGCTGAAGCGGG - Intergenic
1136182391 16:28562654-28562676 CACTTTAAGGAGGCTGAGGCGGG + Intronic
1136215649 16:28791047-28791069 CAGTTTAGGGAGGCTGAAGCGGG + Intergenic
1136260374 16:29070883-29070905 CAGTTTAGGGAGGCTGAAGCGGG + Intergenic
1139509395 16:67418102-67418124 CACTTTAAGGAGGCTGAGGCAGG + Intergenic
1141583808 16:85019469-85019491 CACTTTTAAGAGGCTGAGGCGGG + Intergenic
1142685033 17:1572658-1572680 CAGGGTACAGAGGCTGTGGCTGG - Intronic
1142687825 17:1587884-1587906 CAGGGTACAGAGGCTGTGGCTGG - Intronic
1143543898 17:7585288-7585310 CACTTTAAGGAGGCTGAGGCAGG + Intronic
1146319875 17:31838839-31838861 CATTTTGAAGAGCCTTTTGCAGG + Intergenic
1147616762 17:41833846-41833868 CACTCTAAAGGGGCTGTTCCAGG + Intronic
1149039447 17:52170681-52170703 GAGTTTCAAGAGGCTGATGGGGG + Intergenic
1149821347 17:59781081-59781103 AAGTGGAAAGAGACTGTTGCCGG + Intronic
1152106610 17:78333166-78333188 CAGTTTAATGCGGCGGTGGCAGG - Intergenic
1156008999 18:32474597-32474619 CAGTCAAAAGAGGGTATTGCAGG - Intergenic
1156265580 18:35485269-35485291 CAGTTTGAAGAGGCTCCTACTGG + Intronic
1157466477 18:47951152-47951174 CAATTTAAAGATGTTGTAGCTGG + Intergenic
1163450672 19:17375455-17375477 CAGTTTAAAAAAAATGTTGCTGG + Intronic
1167940402 19:52942035-52942057 CATTTTCCAGAGGCTGGTGCAGG + Intronic
925919296 2:8628192-8628214 CAGCTTTAAGAGACTATTGCTGG + Intergenic
928012880 2:27627484-27627506 CAGTTTGAAGCGGAAGTTGCAGG - Exonic
930303494 2:49647799-49647821 CAGTTTTAGGAGCCTGTTGGAGG + Intergenic
933477878 2:82816119-82816141 GAGTTGAAAGAGGTTGTTGGCGG - Intergenic
934216290 2:90034720-90034742 CTGTTTCAAGAGGGTGTGGCAGG - Intergenic
935819896 2:106884481-106884503 CAGTTTAGAGAGGCTTTGGATGG - Intronic
937202688 2:120215576-120215598 GAGTTGAAAGAGGTTGTTGGTGG - Intergenic
937952523 2:127399442-127399464 CAGTTTAATGAGACTGCTTCTGG + Intergenic
938275552 2:130018017-130018039 CACTTTTAAGAGGCTGAGGCAGG + Intergenic
938326500 2:130408714-130408736 CACTTTTAAGAGGCTGAGGCAGG + Intergenic
938363438 2:130712741-130712763 CACTTTTAAGAGGCTGAGGCAGG - Intergenic
939243828 2:139597080-139597102 CAGTGTACAGAGGCTGAGGCAGG + Intergenic
939625335 2:144470029-144470051 CAATTTAAATAAGCTGTTTCAGG - Intronic
939991141 2:148877004-148877026 CAGTTTACCGAGGGTATTGCAGG + Intronic
940837167 2:158535664-158535686 CACTTTAGAGAGGCTGAGGCAGG - Intronic
941033266 2:160537176-160537198 AAGTTTAAATAGGCAGTTGCTGG + Intergenic
942209655 2:173657933-173657955 CAGGTAAAAGAGGGAGTTGCTGG + Intergenic
942960570 2:181825493-181825515 CAATTTAAAGAGGATGGTCCAGG + Intergenic
945113579 2:206388782-206388804 CAGTTTAAAGAGGCTTTCATTGG + Intergenic
945525145 2:210878845-210878867 CAGTTACAAGAGGCTGAGGCAGG + Intergenic
947295188 2:228623072-228623094 CAGGTTAGACAGGCAGTTGCTGG - Intergenic
948261212 2:236605776-236605798 TAGTTTGACGAGGCTGTTGGGGG - Intergenic
949007949 2:241660899-241660921 CGGATTAGGGAGGCTGTTGCTGG + Intronic
1169021800 20:2335990-2336012 CACTTTGAAGATGCTGTTGCTGG - Intronic
1170162911 20:13333537-13333559 CAGTGTAAAGAGTTTGTGGCAGG - Intergenic
1171122316 20:22578043-22578065 GAGTTTGAAGAGGCTGAGGCCGG - Intergenic
1179958248 21:44753037-44753059 GAATCTAATGAGGCTGTTGCTGG - Intergenic
1181863296 22:25835868-25835890 CAGACTGCAGAGGCTGTTGCTGG + Intronic
1183594049 22:38799103-38799125 CTGTTTAAAGTGGCTGATGGTGG + Intergenic
949557032 3:5163570-5163592 CACTTTAAAAAGACTGCTGCTGG + Intronic
949781487 3:7693821-7693843 GACTTTTAAGAGGATGTTGCTGG - Intronic
952891641 3:38046179-38046201 GAGATTAAACAGGCGGTTGCTGG + Intronic
953846922 3:46434934-46434956 CAGGTTTCAGAGGCTTTTGCAGG + Intergenic
954362625 3:50130290-50130312 CAGTTTCAAGAGGCTGAAGAAGG - Intergenic
954880094 3:53829538-53829560 CTGTTTAAAAAGGCAGTTTCAGG - Intronic
958728507 3:97935303-97935325 CAGTTTAAAGAATCTGCAGCGGG + Intronic
960205506 3:114892696-114892718 CAGTTTGAAGCAGCTGTAGCTGG - Intronic
960839364 3:121940710-121940732 CAGTTTAACCAGACTTTTGCTGG - Intronic
960908776 3:122627719-122627741 CAGTTTAGGGAGGCTGTTGATGG - Intronic
963001601 3:140686890-140686912 CAGTTTAAGGATGCTATGGCAGG - Intronic
964871394 3:161317189-161317211 AAGGTTAAACAGGCAGTTGCTGG - Intergenic
965491922 3:169348272-169348294 AAGTAAAAAGAGGCTGTTTCTGG + Intronic
965801885 3:172502925-172502947 CATTTTAAAGTAGCTGATGCAGG - Intergenic
967056672 3:185835251-185835273 CAGCTTGAAGGGGCTGTTGCTGG - Intergenic
971114190 4:23624641-23624663 CAGTTTCAAGAGTCTTTTGGTGG - Intergenic
971126197 4:23757931-23757953 CAGGTTAGAGAGTGTGTTGCAGG + Intronic
979567119 4:122166909-122166931 CAGCTTAAAGAGGCTCCCGCTGG - Intronic
981736404 4:147956980-147957002 AAGTTTAAAGAGTTTGTTGAAGG + Intronic
984561579 4:181276866-181276888 CTTTTTAAAGAGACTGTTGGTGG + Intergenic
985145921 4:186894438-186894460 CAGTTAAAAGTGGCTGCTTCTGG - Intergenic
986327137 5:6684792-6684814 CACTGTGCAGAGGCTGTTGCAGG + Intergenic
992631983 5:78690486-78690508 CAGTTTAAATAGGCTTATGAGGG + Intronic
993765819 5:91857065-91857087 CAATTTAAAGACACTGATGCAGG + Intergenic
994748900 5:103713926-103713948 CAGTTAAAAGAGGCTAAGGCAGG + Intergenic
998750271 5:145313525-145313547 CAGCATAAAGAGGCTATTGTCGG - Intergenic
999493411 5:152073610-152073632 CAGTTTTGCAAGGCTGTTGCGGG + Intergenic
1003283861 6:4717184-4717206 TACTTTAAAGAGGCTGAGGCAGG + Intronic
1004249120 6:14007899-14007921 CATTTTTCAGAGCCTGTTGCTGG + Intergenic
1004296260 6:14414250-14414272 CAATTTAAAGAGGCTATTCTCGG - Intergenic
1005566254 6:27097515-27097537 CAGTATAACGATGGTGTTGCTGG + Intergenic
1006983214 6:38162069-38162091 CAGGTTCCAGAGGGTGTTGCTGG + Intergenic
1008572203 6:52826715-52826737 AAGTTTAAACAGGCAGTTGATGG - Intergenic
1013317409 6:108955943-108955965 CATTTTACAGAGGCAGTTTCTGG - Intronic
1016215030 6:141589162-141589184 CAGTTTAAAGAGCCTTTTTATGG + Intergenic
1017821829 6:158054424-158054446 CAGCTTAAAGGGGCTTTTGCTGG - Intronic
1017970596 6:159309395-159309417 CAGGTTAAAGATGGTGATGCAGG - Intergenic
1018940564 6:168307021-168307043 CATTTTAAAGAGGCGGTTGCAGG - Exonic
1020489103 7:8757074-8757096 CAGTTTAAAAAGTCAGTTTCTGG - Intergenic
1020970755 7:14935142-14935164 CAATTTAAAGTGGCTTTGGCAGG + Intronic
1021275283 7:18642452-18642474 CAGTTTAAAGGTTTTGTTGCTGG + Intronic
1022947289 7:35299768-35299790 CAATAAAAAGGGGCTGTTGCAGG - Intergenic
1023214994 7:37852475-37852497 CAGATTACAGAGGATTTTGCTGG - Intronic
1025777867 7:64574901-64574923 CAGTCTGAAGTGGCTGTGGCGGG + Intergenic
1025859955 7:65317466-65317488 AAGTTTAAAGAGGCTGGAGAAGG - Intergenic
1026420049 7:70225945-70225967 CAGTTTACAGAGGCTGGAGATGG - Intronic
1027399651 7:77794379-77794401 CAGTTTAAAGAGGCTGTTGCAGG + Exonic
1027861456 7:83588086-83588108 AAGTTTAAAGAAGCTGAGGCCGG + Intronic
1030331911 7:108279858-108279880 CAGCATAAAGATGGTGTTGCAGG - Intronic
1030519756 7:110583411-110583433 CAACTTAAAGAGGCTTCTGCTGG + Intergenic
1030982458 7:116202310-116202332 CAGCTTGAAGAGTCTCTTGCTGG - Intergenic
1031687071 7:124744219-124744241 CAGTTTAAATAGGCTGGTAGGGG - Intergenic
1031826563 7:126573082-126573104 CATTTAAAAGAGGATGTTGCTGG - Intronic
1032349218 7:131144675-131144697 CTTTTTAAAGAGGCTGATGCAGG + Intronic
1032419074 7:131763297-131763319 GAGGTTAAACAGGCAGTTGCTGG - Intergenic
1033182791 7:139197304-139197326 CAGTTTAAAGGAGCTCTTGCTGG - Intergenic
1035014366 7:155752067-155752089 CAGTTTAAAGGGGCTCTCACTGG - Intronic
1040012208 8:42671424-42671446 CACTTTGAAGAGGCTGAGGCAGG - Intergenic
1043782758 8:84356611-84356633 CAGTTTAGAGAGGCCATGGCTGG - Intronic
1046133104 8:109992759-109992781 CCCTTTAAAGTGGGTGTTGCAGG - Intergenic
1049633581 8:143673233-143673255 GAGGTTACAGTGGCTGTTGCTGG + Intergenic
1050002256 9:1090089-1090111 CAGCTTGAAGGGGCTGTAGCTGG + Intergenic
1050242672 9:3654282-3654304 CAGTTCTAAGAGGCTTTTGATGG + Intergenic
1051986218 9:23090754-23090776 CAGTTTTAATATGCTGTTCCTGG - Intergenic
1052205707 9:25837351-25837373 CAGTGTAAAGATGCTGTTCCTGG + Intergenic
1055162270 9:73144685-73144707 ATTTTTAAAGAGGCTGTGGCAGG - Intergenic
1055245311 9:74234425-74234447 GAGTTTAAATAGGTGGTTGCTGG + Intergenic
1057291956 9:93812550-93812572 GAGATGAAAGAGGCTGTTCCAGG - Intergenic
1058189165 9:101891913-101891935 CAGTTTACAGAGGCTGTGCACGG + Intergenic
1059133362 9:111778520-111778542 CAGTTTTGAGAGGCTGTGGTGGG + Intronic
1059366418 9:113789901-113789923 CAGTTTAGGGATGCTGTGGCAGG + Intergenic
1060246050 9:121947026-121947048 CAGATTAAAGATCCTGTTCCAGG + Intronic
1060912755 9:127363743-127363765 CTGTATGAAGAGGCTGCTGCTGG + Intronic
1061889909 9:133613298-133613320 CGGATCAAAGGGGCTGTTGCTGG - Intergenic
1187180288 X:16937682-16937704 AAGTTTAGACAGGCAGTTGCTGG - Intergenic
1187767303 X:22656481-22656503 CAGTTCTAAGAGTCTTTTGCTGG - Intergenic
1188984929 X:36760718-36760740 CAGCTTAAAAAGGATGTGGCAGG - Intergenic
1190855379 X:54289241-54289263 CAGTGTAAAGAGGATGCTCCAGG + Intronic
1193532298 X:82670657-82670679 TAGTTTAAAAAGGCTCTTTCAGG - Intergenic
1195932007 X:110087841-110087863 CAGTCTAAAGAAGCTTTTGAAGG + Intronic
1196151723 X:112381685-112381707 CAGTTTGAAGCGGAAGTTGCAGG + Intergenic
1199206245 X:145152006-145152028 CAGTTTAAAGAGCTTTTTGGAGG - Intergenic
1200417898 Y:2932008-2932030 CAGTTTGAAGAGGCTTGTACTGG - Intergenic