ID: 1027400190

View in Genome Browser
Species Human (GRCh38)
Location 7:77798787-77798809
Sequence CGCGCAGTGACTGCAGGCTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 113}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027400180_1027400190 0 Left 1027400180 7:77798764-77798786 CCTCCTCCCATCCTCCCTGCCCG 0: 1
1: 0
2: 14
3: 185
4: 1606
Right 1027400190 7:77798787-77798809 CGCGCAGTGACTGCAGGCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 113
1027400178_1027400190 2 Left 1027400178 7:77798762-77798784 CCCCTCCTCCCATCCTCCCTGCC 0: 1
1: 2
2: 57
3: 826
4: 5732
Right 1027400190 7:77798787-77798809 CGCGCAGTGACTGCAGGCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 113
1027400181_1027400190 -3 Left 1027400181 7:77798767-77798789 CCTCCCATCCTCCCTGCCCGCGC 0: 1
1: 0
2: 3
3: 59
4: 713
Right 1027400190 7:77798787-77798809 CGCGCAGTGACTGCAGGCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 113
1027400177_1027400190 5 Left 1027400177 7:77798759-77798781 CCGCCCCTCCTCCCATCCTCCCT 0: 1
1: 16
2: 350
3: 3137
4: 21337
Right 1027400190 7:77798787-77798809 CGCGCAGTGACTGCAGGCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 113
1027400172_1027400190 23 Left 1027400172 7:77798741-77798763 CCGCCCTCTCGGGACGCCCCGCC 0: 1
1: 0
2: 2
3: 20
4: 242
Right 1027400190 7:77798787-77798809 CGCGCAGTGACTGCAGGCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 113
1027400182_1027400190 -6 Left 1027400182 7:77798770-77798792 CCCATCCTCCCTGCCCGCGCGCA 0: 1
1: 0
2: 1
3: 13
4: 137
Right 1027400190 7:77798787-77798809 CGCGCAGTGACTGCAGGCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 113
1027400183_1027400190 -7 Left 1027400183 7:77798771-77798793 CCATCCTCCCTGCCCGCGCGCAG 0: 1
1: 0
2: 2
3: 24
4: 383
Right 1027400190 7:77798787-77798809 CGCGCAGTGACTGCAGGCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 113
1027400176_1027400190 6 Left 1027400176 7:77798758-77798780 CCCGCCCCTCCTCCCATCCTCCC 0: 1
1: 0
2: 64
3: 881
4: 6821
Right 1027400190 7:77798787-77798809 CGCGCAGTGACTGCAGGCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 113
1027400173_1027400190 20 Left 1027400173 7:77798744-77798766 CCCTCTCGGGACGCCCCGCCCCT 0: 1
1: 0
2: 1
3: 15
4: 180
Right 1027400190 7:77798787-77798809 CGCGCAGTGACTGCAGGCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 113
1027400174_1027400190 19 Left 1027400174 7:77798745-77798767 CCTCTCGGGACGCCCCGCCCCTC 0: 1
1: 0
2: 4
3: 36
4: 251
Right 1027400190 7:77798787-77798809 CGCGCAGTGACTGCAGGCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 113
1027400179_1027400190 1 Left 1027400179 7:77798763-77798785 CCCTCCTCCCATCCTCCCTGCCC 0: 1
1: 3
2: 86
3: 1354
4: 12525
Right 1027400190 7:77798787-77798809 CGCGCAGTGACTGCAGGCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 113
1027400175_1027400190 7 Left 1027400175 7:77798757-77798779 CCCCGCCCCTCCTCCCATCCTCC 0: 1
1: 0
2: 35
3: 375
4: 3329
Right 1027400190 7:77798787-77798809 CGCGCAGTGACTGCAGGCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027400190 Original CRISPR CGCGCAGTGACTGCAGGCTC CGG Exonic
904461531 1:30683622-30683644 AGCGCAGTGGATGGAGGCTCTGG - Intergenic
904720087 1:32500928-32500950 CGCGCAGAGACAGCAGCCGCCGG + Intronic
908741221 1:67329701-67329723 GGCCCAGTAACAGCAGGCTCTGG + Exonic
920333719 1:205229891-205229913 GCCACAGGGACTGCAGGCTCAGG + Intronic
922766437 1:228158814-228158836 CGCGCAGCGCCTGCAGGGCCAGG - Exonic
924037497 1:239952556-239952578 CATGCAGCCACTGCAGGCTCTGG - Intergenic
924946705 1:248851345-248851367 CAAGCAGGGAGTGCAGGCTCAGG - Intronic
1063203034 10:3803561-3803583 CCCACAGTGACTCCAGCCTCTGG + Intergenic
1073461556 10:103668523-103668545 TGCGCAGGGCCTGCAGGCACCGG + Intronic
1073511865 10:104047480-104047502 CGTGCAGTGGCTGTAGGCCCTGG - Intronic
1075949809 10:126467503-126467525 CCCACAGTCACTGCAGGATCTGG + Intronic
1076657212 10:132032643-132032665 TACACAGTGACTGAAGGCTCTGG - Intergenic
1076734409 10:132452292-132452314 CACCCAGAGACTGCAGGGTCGGG - Intergenic
1077021573 11:419404-419426 CGCCCACTGACGGCAGGCCCTGG - Intronic
1077302128 11:1852256-1852278 CACGCAGTGGCTCCAGGGTCAGG - Intergenic
1077910931 11:6570853-6570875 CCTGCAGTGACTCCAGCCTCCGG - Exonic
1078451656 11:11444910-11444932 CCCACAGTCACTGCAGTCTCTGG - Intronic
1081872686 11:46390749-46390771 CACGCAGTTCCTGCAGCCTCTGG + Intergenic
1083396022 11:62392645-62392667 CCCACAGTGTCTGCAGGCTGTGG - Exonic
1097925312 12:65121116-65121138 CCCGCAGTGCCAGCAGGCACAGG + Exonic
1097925445 12:65121637-65121659 CGCACTGTGAATGCAGCCTCGGG - Intergenic
1098975403 12:76896717-76896739 GCTGCAGTGACTGCAGGCTTAGG + Intergenic
1102060347 12:109926617-109926639 CCCCCAGTCTCTGCAGGCTCAGG + Intronic
1104310482 12:127650378-127650400 GGCCCAGTGACTGGAAGCTCAGG + Intergenic
1105975207 13:25467279-25467301 CGCCTAGTGGGTGCAGGCTCCGG - Intronic
1109440104 13:62358350-62358372 AATGCAGTGACTGCAGGCTTAGG + Intergenic
1110588048 13:77218459-77218481 AGAGCAGTGACTACAAGCTCAGG + Intronic
1113208867 13:107951281-107951303 CGCGTTGTCACTGCTGGCTCAGG + Intergenic
1113773703 13:112929774-112929796 GGCGGAGTGACCACAGGCTCGGG + Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1119201375 14:72755274-72755296 AGCACAGTGACTGCTGTCTCAGG - Intronic
1119781446 14:77278909-77278931 CGGGCAGAGATTCCAGGCTCTGG + Intronic
1123023643 14:105413523-105413545 CACGCTCTGACTGCAGCCTCAGG - Exonic
1123406223 15:20020788-20020810 CTCGCGGTGACTGCTGTCTCTGG + Intergenic
1126185798 15:45829590-45829612 CTCCCAGTCCCTGCAGGCTCAGG - Intergenic
1129329787 15:74821118-74821140 CCCGCAGAGCCTGCAGGATCCGG - Exonic
1129722560 15:77886411-77886433 AGCAGAGTGACTGCAGCCTCAGG - Intergenic
1134482989 16:14634225-14634247 CGTGCAGTCCCTGCCGGCTCGGG - Intronic
1135976322 16:27110791-27110813 CTGGCAGGGACTGCAGCCTCTGG - Intergenic
1137686943 16:50392818-50392840 GGCTCAGTGGCTGCAGGCTTTGG + Intergenic
1139651176 16:68362920-68362942 ATCGCTGTGACTGCAGTCTCGGG + Intronic
1140408980 16:74730062-74730084 CCCGCTGTGGCTGCAGGCTTTGG - Intronic
1142194851 16:88734633-88734655 CGAGCAGTGAGTCCAGGCTGGGG - Exonic
1142590578 17:1003845-1003867 GGCGCAGTGACTGGAGGTTTCGG + Exonic
1145987231 17:29055186-29055208 CTCTCAATGACAGCAGGCTCGGG - Exonic
1148457188 17:47817291-47817313 GGTGCAGGGACTCCAGGCTCTGG + Exonic
1151477913 17:74354280-74354302 CGCTCAGTGAGTGCAGGGACAGG - Exonic
1152139046 17:78525687-78525709 CACGCAGGGACTGCCTGCTCTGG + Intronic
1152596234 17:81239074-81239096 CGCGCAGTGATTGGAGGGCCCGG - Exonic
1152883026 17:82831226-82831248 CGCGCAGGGAGTGCAGCCACGGG - Exonic
1155107437 18:22681423-22681445 GGAGCAGTGACTTCAGGGTCAGG + Intergenic
1158281969 18:55838390-55838412 CGAGGAGACACTGCAGGCTCTGG - Intergenic
1160676154 19:392456-392478 CCCGCTGTCCCTGCAGGCTCTGG - Intergenic
1162110992 19:8399706-8399728 AGCACAGTGCCTGCAGGCCCTGG + Intronic
1162648733 19:12068864-12068886 AGCCCAGTGACTGCAAGCTAAGG + Intronic
1163789379 19:19297509-19297531 CTGGCAGTGACTGCTGGTTCTGG + Intronic
1163801395 19:19367918-19367940 CGGGTGGGGACTGCAGGCTCTGG + Intergenic
1165157342 19:33796487-33796509 CGCGCGGCGACTCCTGGCTCGGG - Intronic
1166317973 19:41999179-41999201 CGCGCAGTGACAGCAGGGCCCGG + Exonic
1167358987 19:49019940-49019962 CGCGTGGGGTCTGCAGGCTCTGG + Intergenic
1167366671 19:49058177-49058199 CGCGTGGGGTCTGCAGGCTCTGG + Exonic
932621881 2:73269552-73269574 CGCGCAGCGACGACAGGCTCCGG + Exonic
932739821 2:74282920-74282942 CGGGCAGTGGCTTCAGGCCCTGG + Intronic
933844374 2:86313755-86313777 GGCCCAGTTACTGCAGGCTGTGG - Intronic
933946977 2:87295379-87295401 CTGGCAGTGACTCCAGCCTCAGG - Intergenic
935529758 2:104218044-104218066 CTGGCAGTGGCTGCAGGCTGTGG - Intergenic
936333213 2:111566176-111566198 CTGGCAGTGACTCCAGCCTCAGG + Intergenic
941916143 2:170815264-170815286 CGCGCGGTGACTGCAGCCCCGGG - Intronic
945251131 2:207767536-207767558 CGCGCAGCGAGTTCAGGTTCTGG + Exonic
945888028 2:215397790-215397812 CGAGAAGTGACTTCAGACTCAGG - Exonic
946404102 2:219483655-219483677 GGCGCAGGGCCTGCAGCCTCTGG - Exonic
948421455 2:237863043-237863065 CTTGCAGGGACGGCAGGCTCAGG + Intronic
1173010328 20:39176256-39176278 CGTGCAGTGTCTGCAGCCACTGG - Intergenic
1173840088 20:46151495-46151517 CGCACAGTGCGTGCTGGCTCAGG + Intergenic
1175115541 20:56679350-56679372 TGAGCTGTGACTGCAGGCACTGG + Intergenic
1176230019 20:64027825-64027847 CGTGCAGTGCTTCCAGGCTCAGG + Intronic
1178316508 21:31570822-31570844 AGCGCAGTGCCTGGAGCCTCAGG + Intergenic
1179180828 21:39043535-39043557 GTCCTAGTGACTGCAGGCTCCGG - Intergenic
1179499626 21:41799756-41799778 CTCCCAGTGAGTGCAGGATCTGG + Intronic
1180791733 22:18578459-18578481 CCAGCAGTGACTGCAAGCTCGGG + Intergenic
1181230003 22:21416850-21416872 CCAGCAGTGACTGCAAGCTCGGG - Intergenic
1181248646 22:21518016-21518038 CCAGCAGTGACTGCAAGCTCGGG + Intergenic
1185312767 22:50165804-50165826 CACGCTGGGACTGCAGGCTTGGG - Intergenic
950467164 3:13162358-13162380 CTCGGAGGGGCTGCAGGCTCAGG - Intergenic
950496975 3:13339718-13339740 CCTGCAGTGACTGCAGACCCAGG + Intronic
952970836 3:38649424-38649446 CACGCAGGGACTGGAGGCTTCGG + Intronic
962825763 3:139100065-139100087 TGCACACTGACTGCAGGCACAGG - Intronic
973162188 4:47032360-47032382 CTCTCAGTGACAGCAGGCTGGGG - Intronic
975883587 4:78939313-78939335 CGCGCAGCGTCCGCGGGCTCCGG - Exonic
988135036 5:27159362-27159384 ACTGCAGTGACTGCAGGCTTAGG - Intergenic
989003338 5:36783399-36783421 CGGGCTGTCACTGCTGGCTCGGG - Intergenic
994373559 5:98993621-98993643 ATCGCAGTCACTGCAGGCTGTGG + Intergenic
996605012 5:125311645-125311667 CCCCCAGTGACTGCAGCCCCAGG + Intergenic
997469381 5:134108433-134108455 TGAGCAGTGACTACAGGATCTGG + Intergenic
997530231 5:134577329-134577351 AGAGGAGTGGCTGCAGGCTCTGG + Intronic
998280566 5:140802980-140803002 CGCGCAGTGGATGCAGACTCAGG + Exonic
998286860 5:140870883-140870905 CGCGCAGTGGATGCGGACTCAGG + Exonic
1002445403 5:179287329-179287351 GGGGCAGTGAGTGCAGGCGCAGG + Intronic
1003537733 6:6990293-6990315 CATGCAGTGACTACATGCTCAGG + Intergenic
1007451010 6:41940597-41940619 CGCACAGTCACTGCTGGGTCTGG + Intronic
1007562476 6:42821470-42821492 CAGGCAGTCTCTGCAGGCTCTGG - Intronic
1008086201 6:47247281-47247303 TGGGGTGTGACTGCAGGCTCTGG - Intronic
1017719730 6:157236150-157236172 CGGGCGGTGACGGCCGGCTCAGG + Intergenic
1018380412 6:163253849-163253871 CACTCAGTGACTGCAGGGCCGGG - Intronic
1019437071 7:1027948-1027970 CTCGCAGTGCCTGCAGGGCCTGG + Intronic
1024548921 7:50544202-50544224 TGGGCAGTGACTGCATGCCCTGG + Intronic
1027400190 7:77798787-77798809 CGCGCAGTGACTGCAGGCTCCGG + Exonic
1029046865 7:97639253-97639275 CCAGCTGAGACTGCAGGCTCTGG + Intergenic
1036707916 8:11059137-11059159 CACGCCGTGGATGCAGGCTCTGG - Intronic
1038256419 8:25955016-25955038 CGCCCAGGGGCTGCACGCTCTGG + Intronic
1039865763 8:41500031-41500053 CGTTCAGTGAGTGAAGGCTCAGG + Intronic
1044890644 8:96831824-96831846 CTCACAATGACTGCAGGCTCAGG - Intronic
1045182829 8:99804494-99804516 GACGGAGTGACTGCAGTCTCTGG + Intronic
1045322600 8:101093264-101093286 CAAGAAGTGACTGAAGGCTCGGG + Intergenic
1053062358 9:35042328-35042350 GCCGCAGTGTCTGCAGGCTAGGG - Exonic
1056056184 9:82826345-82826367 GGCGCACAGACTGCAGGTTCTGG + Intergenic
1061036694 9:128118261-128118283 AGCCCAGTGACTGCGGGCTGTGG - Intergenic
1061834788 9:133321707-133321729 CGCGCAGAGCCTGGACGCTCAGG - Intergenic
1061999775 9:134210072-134210094 CACTCAGTGGCAGCAGGCTCCGG - Intergenic
1185449747 X:275860-275882 CGCTCAGAGCCTGCAGGCTTGGG + Intergenic
1195454331 X:105051272-105051294 CCCCCAGTCCCTGCAGGCTCGGG - Intronic
1200033232 X:153312767-153312789 CGTGCAGGGACTGCAGGCCTGGG + Intergenic