ID: 1027402333

View in Genome Browser
Species Human (GRCh38)
Location 7:77822055-77822077
Sequence ATCAGCTGCTTAGAGACGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 524}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027402328_1027402333 -7 Left 1027402328 7:77822039-77822061 CCAGCCCGAGGGATGTATCAGCT No data
Right 1027402333 7:77822055-77822077 ATCAGCTGCTTAGAGACGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 524
1027402324_1027402333 20 Left 1027402324 7:77822012-77822034 CCTGAGTGCAGATGTGTAGCCTC 0: 1
1: 0
2: 1
3: 11
4: 232
Right 1027402333 7:77822055-77822077 ATCAGCTGCTTAGAGACGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 524
1027402327_1027402333 1 Left 1027402327 7:77822031-77822053 CCTCTCTGCCAGCCCGAGGGATG No data
Right 1027402333 7:77822055-77822077 ATCAGCTGCTTAGAGACGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 524

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027402333 Original CRISPR ATCAGCTGCTTAGAGACGTG GGG Intronic