ID: 1027403353

View in Genome Browser
Species Human (GRCh38)
Location 7:77831956-77831978
Sequence TCTTATATGCAGAAGTAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 298}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027403353 Original CRISPR TCTTATATGCAGAAGTAAGA TGG Intronic
901594582 1:10374696-10374718 TCTTATCTGCCAAAGTAATACGG - Intronic
901932132 1:12602559-12602581 TCTAATATGCAGAAGGAGAAGGG + Intronic
902176044 1:14651864-14651886 TATTATGTGAAGAAGTTAGAAGG - Intronic
908513896 1:64873060-64873082 CCTTATGTGCAGAGGTCAGAGGG - Intronic
908731250 1:67228822-67228844 TCTTATAAGCAGAAGGGAGAAGG - Intronic
909122229 1:71617807-71617829 TCTTATACACAGAAGTGAGATGG + Intronic
911556302 1:99348957-99348979 TTATAAATGCAGAAGTCAGATGG + Intergenic
911767783 1:101700188-101700210 TGGTATATACAGAAGTAAGCAGG - Intergenic
914324176 1:146595336-146595358 TGTTATAGGAAGAAGTGAGAGGG - Intergenic
916850949 1:168702921-168702943 TCTTATAAGTAGAACTAATAGGG + Intronic
917055865 1:170980881-170980903 TCTAATATGCAGAATTTACAGGG + Intronic
917737047 1:177930889-177930911 TCATTTTTGCAGGAGTAAGATGG - Intronic
917757723 1:178119299-178119321 TCTTACACACAGAAGTGAGATGG - Intronic
918674988 1:187272766-187272788 TCTTATATACACAAGTGAAAAGG + Intergenic
918750998 1:188269233-188269255 TCTTATACACAGATGTGAGATGG - Intergenic
919091258 1:192980909-192980931 TCTTATACCCAGAAGTGAGATGG + Intergenic
919354067 1:196499063-196499085 ACACATATGCAGAAGGAAGATGG + Intronic
919534898 1:198775353-198775375 TGTTATATACAGCAGTAACATGG - Intergenic
922978556 1:229805193-229805215 TGTTATTTACAGAAGTAGGAAGG + Intergenic
923387189 1:233476863-233476885 ACTTATCTGCAGAAGTAATTGGG - Intergenic
924003227 1:239576958-239576980 TTTTATATGGAGAAGTAAGTAGG - Intronic
924387938 1:243517485-243517507 TATTAGATGCATAACTAAGACGG + Intronic
1063892302 10:10643014-10643036 TCTTATCTGCAGAACTCAAAGGG - Intergenic
1064445145 10:15386434-15386456 TATTATATGGAGAAAGAAGATGG + Intergenic
1068829637 10:61478732-61478754 TCTAATATACAGAGGTAAAAAGG - Intergenic
1070994695 10:80766322-80766344 TCTTATATGCAGCATATAGATGG + Intergenic
1072818799 10:98536032-98536054 TCTTATATGCAGACAAAAGATGG + Intronic
1074628255 10:115218922-115218944 TCTTATACACAGAAGTGAGGTGG - Intronic
1075660769 10:124194022-124194044 TCTTTTGAGCAGAAGGAAGAAGG + Intergenic
1076501109 10:130936711-130936733 ACTTATGTGCAGAAATAACAAGG - Intergenic
1077746429 11:4911941-4911963 GCTTATAAGCAGAAGTTAGTTGG - Intronic
1077820991 11:5740460-5740482 TCTTATCTCCTGAAGTAAAAAGG + Intronic
1078339299 11:10487510-10487532 GCATATGTGCAGAAGGAAGATGG + Intronic
1078845231 11:15114276-15114298 TCTTATGTGCCGAAGTTAGAAGG + Intronic
1079000511 11:16751065-16751087 TCTTATACACAGAAGAGAGACGG + Intronic
1079570064 11:21932039-21932061 TCGTATACGCAGAAGTGAGATGG + Intergenic
1079999276 11:27328997-27329019 CCTTATGCGCAGAAGTCAGAGGG - Intergenic
1080927452 11:36772694-36772716 TCTTCTATGAAGAAGAAATATGG - Intergenic
1081292001 11:41337798-41337820 TCTAATATTCAGAATTTAGAAGG + Intronic
1082644469 11:55704483-55704505 TCTTATAGGCAGAAGATAGATGG - Intergenic
1086792499 11:91060177-91060199 TCTAATATCCAGAAGTTACAAGG + Intergenic
1086794230 11:91080851-91080873 TCTTATATCCATCATTAAGAAGG + Intergenic
1087404284 11:97710965-97710987 TCTAATATGCAGAATTTACAAGG - Intergenic
1088667596 11:112108952-112108974 TCTTATACACAGAAGTGAGATGG - Intronic
1089074745 11:115729036-115729058 TCTTAGATGGAGAAGGAAGTGGG + Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091151317 11:133330859-133330881 TCTCATTTGCACAATTAAGAGGG + Intronic
1091472988 12:746202-746224 TAATATATGAAGAAGTAAGCGGG - Intergenic
1092028809 12:5266318-5266340 TCTTATAAGTAGCAGTAAAAGGG - Intergenic
1093056408 12:14560354-14560376 TAATATATTCAGAAGTCAGAGGG + Intronic
1093568532 12:20638041-20638063 TCTTATATTCACAAGTTTGATGG - Intronic
1093764556 12:22948078-22948100 TCTCACATTCTGAAGTAAGAGGG + Intergenic
1095985308 12:47995403-47995425 TCTTCTATGAAGAAGAAAGATGG + Intronic
1096686545 12:53291924-53291946 AGGTATATGCAGAAGTCAGAAGG - Intronic
1097281951 12:57850451-57850473 TATTTTAGGCAGAAGTTAGAAGG - Intergenic
1097655337 12:62354539-62354561 TATTATATGCCAAAGGAAGAGGG + Intronic
1098587777 12:72174737-72174759 TCTGATATGAAGCACTAAGAAGG - Intronic
1099240659 12:80134843-80134865 TCTGATATGCAGAGATATGAGGG - Intergenic
1099627506 12:85093493-85093515 TCTTATACAGAGAAGTGAGATGG + Intronic
1100996980 12:100311886-100311908 TCTTATATGTAGTCGTTAGAGGG + Intronic
1101119140 12:101561212-101561234 TCTAATATTCAGAATTAACAAGG - Intergenic
1101485394 12:105152862-105152884 CATTATATGCACAAGTAAAATGG - Intronic
1101861781 12:108488295-108488317 TCTAATATCCAGAATTAATAAGG + Intergenic
1102966917 12:117134981-117135003 TGTTACATGTACAAGTAAGAAGG - Intergenic
1106424965 13:29618983-29619005 TCATATTTGCAGAAGTAAGGTGG - Intergenic
1107682133 13:42863068-42863090 TCCTATACTCAGAAGAAAGAAGG + Intergenic
1109878684 13:68441120-68441142 CCTCATAAGCAGAAGTGAGAAGG + Intergenic
1110174038 13:72535417-72535439 TCTTAAATGCAGAATAAAGCGGG - Intergenic
1110657958 13:78023172-78023194 TCTTATTTGCACAAAAAAGAGGG - Intergenic
1111225138 13:85260934-85260956 TCTTAAAGGGAGAAGGAAGAGGG + Intergenic
1112113195 13:96325135-96325157 TTTTATATGCATAATTGAGAGGG + Intronic
1112214170 13:97413002-97413024 TCTTCTAGGCAGAAGGAACATGG - Intergenic
1112788107 13:102973846-102973868 TCTAACATGCACAAGGAAGAAGG - Intergenic
1113225308 13:108153082-108153104 TGTTATCTGCAGACGTAAGTGGG - Intergenic
1113370471 13:109720437-109720459 TCAGAAATGCAGAAGAAAGAAGG + Intergenic
1113401368 13:109997006-109997028 TCTGATACACAGAAGTGAGATGG + Intergenic
1114522307 14:23347207-23347229 TCAGATCTGCAGAAGCAAGAGGG + Exonic
1115008510 14:28515859-28515881 TTTGATATGCAGAATTAGGAAGG + Intergenic
1115977792 14:39016241-39016263 TGTTATATGCAGTAGTATGTAGG - Intergenic
1116052035 14:39815611-39815633 TATTACATGAAGATGTAAGAAGG - Intergenic
1116142628 14:41018414-41018436 ACTTTTATCCAGAAGTTAGAAGG - Intergenic
1117131122 14:52687801-52687823 TCTAATAAGCAGAGATAAGAAGG + Intronic
1117233051 14:53741936-53741958 TCTTATATTCAAAATTCAGAAGG + Intergenic
1117258701 14:54006852-54006874 TCTTGCATGAAAAAGTAAGATGG - Intergenic
1117312621 14:54543167-54543189 GCTTATATGCAGTCGTAATAGGG + Intergenic
1117573758 14:57076793-57076815 TCTAATATGAATATGTAAGATGG + Intergenic
1117850932 14:59968620-59968642 TACTTTATGGAGAAGTAAGAAGG + Intronic
1118079641 14:62343664-62343686 TCTTAAGTTCAGAAGTAAGAAGG + Intergenic
1118911610 14:70066484-70066506 TCTTAAAGGCAGAAGGAAGGGGG - Intronic
1120141169 14:80931491-80931513 TCTTATACACAGAAGTGAGATGG + Intronic
1120253796 14:82092302-82092324 TAATATATGCAGAAATACGAAGG + Intergenic
1121247105 14:92469555-92469577 TCTTAAATACAGAACTAAGAGGG - Intronic
1125000157 15:34761229-34761251 TATTTTATGCAGAAGTGGGATGG + Intergenic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1126457149 15:48875986-48876008 TCTTACACACAGAAGTGAGATGG + Intronic
1126759925 15:51960733-51960755 TCTTCAATGCAGAAGGAAAAAGG + Exonic
1127225802 15:56927269-56927291 CTTTATATGCAGAAAAAAGACGG - Intronic
1127442011 15:59018886-59018908 AGTTATATGCACAAATAAGAGGG - Intronic
1130045494 15:80440978-80441000 TCTTCATTCCAGAAGTAAGAGGG + Intronic
1130821669 15:87502584-87502606 TCTTTTCTGGTGAAGTAAGAGGG - Intergenic
1131645003 15:94331958-94331980 CCTTATCTGCAAAAGAAAGATGG + Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1134319147 16:13147058-13147080 TCTTATTTGCAGAAAGAATAAGG - Intronic
1134872550 16:17665203-17665225 TCTTATCTGCAGGAGTAACTAGG - Intergenic
1137717418 16:50606846-50606868 TCTTTCATGCAGAAGAGAGACGG - Intronic
1140009382 16:71115509-71115531 TGTTATAGGAAGAAGTGAGAGGG + Intronic
1144364176 17:14526124-14526146 TGTTATCTGCAGGAGTAATAGGG - Intergenic
1144595473 17:16566707-16566729 TCTTAAATCGAGAAGTAAGAAGG + Intronic
1145024313 17:19456307-19456329 TGTTATCTGCAGGAGTAAGTGGG + Intergenic
1146426656 17:32746382-32746404 TCTTATAGGAAGAAGTGGGAAGG - Intronic
1146767124 17:35533627-35533649 TTTTCTAGACAGAAGTAAGAAGG + Intronic
1149062525 17:52439696-52439718 TCTAATATGCAGAATTTATAAGG - Intergenic
1149139986 17:53420672-53420694 TCTTATACACAGAAGTAAGATGG + Intergenic
1151563597 17:74884346-74884368 TCTGAAATTCAGAATTAAGAGGG - Intronic
1152745149 17:82035184-82035206 TCGTGTATGCAGAAATAAGTAGG - Intronic
1154962349 18:21322112-21322134 TATTATAAGCAGAATTCAGAAGG + Intronic
1155112187 18:22726852-22726874 TCTTATACACAGAAGTGAGATGG + Intergenic
1155488822 18:26377446-26377468 TCATATATGCAGAGTTAAGAAGG - Intronic
1155702100 18:28758921-28758943 TCTTATATGAAGGAGTTGGATGG + Intergenic
1158808790 18:61007122-61007144 TCTAATATGCAGAAGTAAGTAGG + Intergenic
1159157599 18:64604673-64604695 TCTAATATGCAGAATTTACAAGG - Intergenic
1159403708 18:67972526-67972548 TCTAATATGCAGAATTTATAAGG - Intergenic
1159792478 18:72799737-72799759 TCTTACACACAGAAGTGAGATGG + Intronic
1160066042 18:75575256-75575278 TCCCAAATGCATAAGTAAGATGG + Intergenic
1163810278 19:19427092-19427114 TCTTAAAGACAGAAGGAAGAAGG + Intronic
1164533389 19:29065041-29065063 TCTTTTATCCAGCAGTGAGATGG - Intergenic
1164692944 19:30224347-30224369 TAATATAAGCAGAAGTAACAAGG - Intergenic
1167782463 19:51608060-51608082 TCTCAAATGCAGAGGTAAGAAGG - Intergenic
1168456844 19:56518646-56518668 TCTGAGATGCATAAGTGAGAAGG - Intronic
925568473 2:5283123-5283145 TCCTATATGCAGAAGCTGGAAGG + Intergenic
926668673 2:15553473-15553495 GCTTTTATGGAGAAGAAAGAGGG + Exonic
926824644 2:16892239-16892261 TCTTATATACAGAAGTGAAATGG + Intergenic
927562474 2:24083867-24083889 CCTTATCTGTAGAATTAAGATGG + Intronic
927667907 2:25044846-25044868 TCCCATAAGCAGAAGGAAGAAGG - Intronic
928144635 2:28761438-28761460 TCATATATGCAGAAGAAACTGGG - Intronic
928321407 2:30285568-30285590 GTTTATATGCACAAGTAAAATGG - Intronic
928887972 2:36171739-36171761 TCCTATATACAGAAATAAAAAGG + Intergenic
929388884 2:41444639-41444661 TGTTATATGCATAAATAGGATGG + Intergenic
929832700 2:45360010-45360032 TGTTATTTCCAGGAGTAAGAAGG - Intergenic
930285882 2:49427318-49427340 TTTAAAATGCAGAAGTAAAATGG - Intergenic
930371133 2:50502525-50502547 TCTTATATTCAGAGCTAAGGAGG - Intronic
930567514 2:53041149-53041171 TCTAATATGCAGAATTTATAAGG - Intergenic
930998321 2:57749759-57749781 TCTTACATTCAGAAGTCAAATGG + Intergenic
931750883 2:65328913-65328935 TTTCATTTGCAGAAGTAAAAGGG - Intronic
932991546 2:76794247-76794269 TCTTATACTCAGAAGAGAGAAGG + Intronic
933480587 2:82852118-82852140 TCTTATACACAGAAGTGAGTTGG - Intergenic
934960727 2:98670179-98670201 CCTTTTAGGCAGGAGTAAGATGG + Intronic
935231436 2:101101158-101101180 TCTAATATCCAGAAGTTACAAGG + Intronic
937656877 2:124386936-124386958 TCTTATAATCAGAAGCCAGAGGG + Intronic
937709077 2:124958282-124958304 TCTACTATGCAGATGTAACATGG - Intergenic
937824689 2:126355524-126355546 TCTGTAATGAAGAAGTAAGAAGG + Intergenic
939723443 2:145683814-145683836 TCTTATTTGAAGAAGTAATATGG - Intergenic
941399734 2:165015783-165015805 TCTAAAATGCTGAGGTAAGAAGG - Intergenic
941650482 2:168087207-168087229 GCTTACCTGCAGAAGAAAGAGGG + Intronic
942215766 2:173717797-173717819 TCTTGGACTCAGAAGTAAGAGGG - Intergenic
942260363 2:174154960-174154982 TTTGAAAGGCAGAAGTAAGAAGG - Intronic
943232414 2:185271721-185271743 TCTAATATGCAGAATTTACAAGG + Intergenic
943819068 2:192295702-192295724 TCATATCTGCAGAAGGAATAGGG + Intergenic
944074917 2:195718892-195718914 TCTTATTTTATGAAGTAAGAAGG + Intronic
945770827 2:214040113-214040135 TGTTATCTGCAGGAGTAATAGGG + Intronic
945801830 2:214442297-214442319 TCTTTTAGGCAGAAGTGAGAAGG + Intronic
947064236 2:226202565-226202587 TTTTGTATGCTGAAGTAAAATGG + Intergenic
947475141 2:230439040-230439062 TCTTTCTTGCAGAAGTAAGGTGG + Intronic
948640425 2:239372316-239372338 TCTTAAAGGCAGGAGTAAGGAGG - Intronic
1169781874 20:9318484-9318506 TGTTATTTGCAGAAGTAACTGGG + Intronic
1171233045 20:23502543-23502565 TCTTATGTGCAGCAGGAAGCAGG - Intergenic
1172285608 20:33738295-33738317 TATTATATGCAGGAGTAATTGGG + Intronic
1174675776 20:52353106-52353128 TCTTGTAGGCAGAATTAAGATGG + Intergenic
1175418855 20:58818700-58818722 TCTTGTATGCAGCAGTAAGAAGG + Intergenic
1177107629 21:16979572-16979594 TTTTATAAGCAGAAGCAAGAGGG + Intergenic
1178597949 21:33972017-33972039 TCTTATAAGAAGAAGGCAGAGGG - Intergenic
1183002191 22:34869937-34869959 TCCTGTGTGCAGAAGTAAGAGGG + Intergenic
1183714343 22:39525082-39525104 TCTTAGCTGCATCAGTAAGAGGG - Intergenic
1184825542 22:46948246-46948268 TCTTAAATTGACAAGTAAGATGG + Intronic
1185101911 22:48845141-48845163 TCAGAGATGTAGAAGTAAGAAGG - Intronic
949278348 3:2315570-2315592 TGTTATAATCAGAAGTAAAAAGG + Intronic
950626509 3:14251378-14251400 TGTTATCTACAGGAGTAAGAGGG + Intergenic
950758489 3:15198637-15198659 TCTTATACACAGAAGTGAGGTGG - Intergenic
952386882 3:32848385-32848407 TCTTGTCTGCAGAAGTCAGCTGG + Intronic
952716044 3:36482108-36482130 TCTGATATCCCAAAGTAAGATGG - Intronic
952813294 3:37424345-37424367 TCCTTTATGCAGAAGGCAGATGG - Intronic
953328268 3:42030889-42030911 TTTCATTGGCAGAAGTAAGAAGG + Intronic
953341418 3:42137298-42137320 CCTGATATCCAGAAGTAAAAGGG - Intronic
955138125 3:56240548-56240570 TCTTAAATTCAGAAGAAATATGG - Intronic
956039178 3:65128334-65128356 TCTTTTAGGCAGAAGTTATAAGG + Intergenic
956152931 3:66262142-66262164 TCTTATATGAAGAGGTGAGATGG + Exonic
957717368 3:83946091-83946113 CCTTATATAGAGAGGTAAGATGG + Intergenic
957956993 3:87200039-87200061 TCTCATATGCAGAAATAAAGTGG - Intergenic
957976286 3:87448838-87448860 CTTGATATGCAGAGGTAAGAAGG + Intergenic
958103200 3:89039957-89039979 TCTTGTATGCAGAAATCAGAAGG + Intergenic
958780435 3:98534447-98534469 TCTAATATTTAGAAGTAAAATGG - Intronic
960345009 3:116520232-116520254 TCTAATATGCAGAAATTACAAGG - Intronic
960523140 3:118678984-118679006 TCTAATATCCAGAATTTAGAAGG - Intergenic
961832407 3:129630534-129630556 TCTACTATGGAGAAGTAGGATGG + Intergenic
962092162 3:132255775-132255797 TCTTATAAGGAGAGGAAAGATGG + Intronic
962485234 3:135835996-135836018 TCTTATAGGAAAAAGTGAGATGG + Intergenic
962888469 3:139650177-139650199 TATTATATGGAGAAGAGAGAGGG - Intronic
963537539 3:146546413-146546435 TCTTATACACAGAAATGAGATGG - Intergenic
963617779 3:147564700-147564722 TCTTATAAGCAGAATAAAGTTGG - Intergenic
964081765 3:152767527-152767549 TCTAATATCCAGAATTTAGAAGG + Intergenic
965565078 3:170107121-170107143 ATTTTTATGCAGAAGCAAGAGGG - Intronic
966546037 3:181149544-181149566 TCATATTTGCAGGAGTAAGGTGG - Intergenic
968017775 3:195354553-195354575 TCTTATATCCAGAATTTATAAGG - Intronic
969508588 4:7603875-7603897 TCTCACATGCAGCTGTAAGAAGG + Intronic
970652810 4:18197407-18197429 TTTAAAATGCAGAAGTAAAAAGG + Intergenic
970949763 4:21741099-21741121 TCTTATATGAACAAGAAAGGAGG - Intronic
971037385 4:22708916-22708938 TCTTATATTCAAAAGTAATGTGG + Intergenic
971651022 4:29274237-29274259 TCTTAAGTGCTGAAGTGAGAGGG - Intergenic
972713521 4:41622812-41622834 TCTCATATGCAGAAGTTTGCAGG + Intronic
973125237 4:46574880-46574902 TCTTAGATGAGGAAGTTAGAGGG - Intergenic
973134042 4:46683684-46683706 TCTTAAATGCATAATTCAGAAGG + Intergenic
974168686 4:58238107-58238129 TCTTCTATGCAGAAGCTGGAAGG - Intergenic
974554948 4:63434307-63434329 ACTTGTATGCAGATGGAAGATGG + Intergenic
975049284 4:69839823-69839845 TCTTCTTTGGAGAAGTAATACGG - Intronic
975259330 4:72277880-72277902 TCTTATATGCCAAGGGAAGAAGG - Intergenic
975417393 4:74120751-74120773 TCTTATATACATAAGTGAGATGG + Intronic
975625292 4:76339923-76339945 TCTTATACACAGAAGTGAGATGG + Intronic
976180295 4:82392468-82392490 TCTTATACACAGAGGTGAGATGG + Intergenic
977296872 4:95219939-95219961 GCTTACATGCATAAGTAACAGGG + Intronic
977646786 4:99421763-99421785 TCTAATATGCAGAATTTACAAGG + Intronic
978489621 4:109298747-109298769 TCTAATATGCAGAATCAAGCAGG - Intronic
978916739 4:114134722-114134744 GCTAATATGCTGAAGTAAGGAGG - Intergenic
979204425 4:118020422-118020444 GCCTATATGCAGTAGTAAGAAGG - Intergenic
979499170 4:121419048-121419070 TCTCATCTGCAAAAGTAAGTAGG + Intergenic
979587174 4:122434046-122434068 TGGTATATGCAGAAGTGGGAGGG - Intergenic
979596403 4:122539463-122539485 TATTATTTGCATAATTAAGATGG + Intergenic
979623313 4:122819724-122819746 TCTTATACACAGAAGTGAGATGG - Intergenic
979829176 4:125279497-125279519 TCTTATACACAGAAGGGAGATGG + Intergenic
980116254 4:128682078-128682100 TTTTAAATGCAGAAATATGAAGG + Intergenic
981038444 4:140196149-140196171 ACTTGTAGGAAGAAGTAAGAGGG - Intergenic
981858400 4:149323849-149323871 TCTAATATCCAGAATTAACAAGG - Intergenic
982335874 4:154237116-154237138 TATTGTATCCAGAAGTAATACGG + Exonic
982644202 4:158002475-158002497 TCTTAGAAGCAGAAGTAGAATGG + Intergenic
982822793 4:159965269-159965291 TCCTATATCCAGAAGTAATAGGG - Intergenic
983278257 4:165645094-165645116 TCATATATTCATAAGTGAGATGG + Intergenic
983309591 4:166041760-166041782 TACCATATGTAGAAGTAAGATGG - Intronic
984008208 4:174339009-174339031 TGTTATAGGTAGAAATAAGAGGG - Intergenic
985753485 5:1697984-1698006 TCTGATATGCAGAAATGAGGTGG - Intergenic
986247165 5:6019837-6019859 TCTTTTAATCAGAACTAAGAGGG - Intergenic
986970687 5:13332705-13332727 TCTTATCTCCAAAAGAAAGATGG + Intergenic
987316435 5:16728941-16728963 TCTTTTAAGCAGCAGCAAGAAGG + Intronic
987598220 5:20029683-20029705 TATTATTTGCAGAATTCAGAAGG + Intronic
987834259 5:23141324-23141346 TCTAATATCCAGAATTTAGAAGG - Intergenic
988075154 5:26342900-26342922 TTTTATATTCAGAAGAAATATGG + Intergenic
989705252 5:44322071-44322093 CCTTATACACAGAAGTGAGATGG + Intronic
990915958 5:60906085-60906107 TGTTATATGCAGGAGTAATTGGG + Intronic
990964633 5:61431793-61431815 TCTTTAATGAAGAATTAAGAGGG - Intronic
993310727 5:86328866-86328888 TCTTAATTACAGAAGTAATAGGG - Intergenic
994617572 5:102125011-102125033 ATTTATATGAAGAAGTAATAAGG + Intergenic
995463972 5:112431748-112431770 TCTCATACACAGAAGTGAGATGG - Intergenic
995861492 5:116645456-116645478 TCTTATACACAGAAGTGAGATGG - Intergenic
996692587 5:126356411-126356433 TTTAATAGGGAGAAGTAAGAGGG + Intergenic
996697202 5:126410989-126411011 TCTAATATGCAGAATCTAGAAGG - Intronic
996897449 5:128502421-128502443 TCATATATACAGAAATATGAAGG + Intronic
997141659 5:131387749-131387771 TCTTAGATGCAGGATTGAGATGG + Intronic
997185976 5:131882487-131882509 TCATATATGTTGTAGTAAGATGG - Intronic
998604069 5:143615613-143615635 TCTTAAAAGGAGAAGAAAGAAGG - Intergenic
999351655 5:150876943-150876965 TCTTATATGATGAAGAAAAAAGG - Intronic
1000575979 5:162975788-162975810 CCTTATAAGCAGAAGCAAGGTGG - Intergenic
1002960094 6:1906217-1906239 GCTTATATGCATATGTAGGATGG - Intronic
1003575605 6:7291773-7291795 TGTTATATGCAGATGTGAGCTGG + Intronic
1004474537 6:15959125-15959147 TGTTATCTGCAGGAGTAATATGG + Intergenic
1004819855 6:19355768-19355790 TCTTTTATGCAGAAATAAAGAGG - Intergenic
1005194266 6:23264831-23264853 CCTTATATGAAGAATTTAGAAGG + Intergenic
1007336344 6:41157613-41157635 TCTTAAATGCAGAAGCCAGAAGG - Intergenic
1008954130 6:57196441-57196463 TCTTGTATAAAGAAGTAAGATGG - Exonic
1009038492 6:58147733-58147755 TCTAATATGCAGAATTTACAAGG + Intergenic
1009214382 6:60902604-60902626 TCTAATATGCAGAACTTACAAGG + Intergenic
1009674209 6:66795893-66795915 TCTTATACTCAGAAGTGAGATGG - Intergenic
1009900187 6:69800276-69800298 CCTTATATGCATAATTAAAAAGG - Intergenic
1011670760 6:89680921-89680943 TCTCATATGGAGCAGTAATATGG - Intronic
1011694329 6:89898288-89898310 TGTTAAGTGCAGTAGTAAGAAGG + Intergenic
1011891603 6:92169328-92169350 TCTTATTTTCAGCAGGAAGAAGG - Intergenic
1012011454 6:93791883-93791905 TCTCATAAGGAAAAGTAAGAAGG - Intergenic
1012420573 6:99060258-99060280 ACTTATCTGCAGAAGTTAGGAGG - Intergenic
1012614486 6:101260038-101260060 TCTTATACTCAGAAGTGAGATGG + Intergenic
1013036124 6:106385202-106385224 TCTTATACACAGAAGTGAGATGG - Intergenic
1013252358 6:108346888-108346910 TCCTATATACAGAACCAAGAGGG - Intronic
1014184213 6:118416868-118416890 TCTTTTATGCATCAGTTAGAAGG - Intergenic
1014353077 6:120368123-120368145 TCTAATATACAGAATTTAGAAGG + Intergenic
1016442543 6:144098661-144098683 TCTTATACACAGAGGTGAGATGG - Intergenic
1017276983 6:152581232-152581254 TTTTATTTGCACAGGTAAGAGGG + Intronic
1018343082 6:162872477-162872499 TCTTATAGACAAAAGTAAGTGGG - Intronic
1018647069 6:165958864-165958886 TCTTTTGGGCAGAAGCAAGAGGG - Intronic
1020463628 7:8451722-8451744 TCTTATATTCAGAAGTATCCTGG + Intronic
1020766718 7:12331192-12331214 TCTTATCTGTAGTAGGAAGAAGG + Exonic
1021174403 7:17434467-17434489 TCTTATATCCAAGAGCAAGATGG - Intergenic
1021466405 7:20949151-20949173 TCTTTCTTGCAGGAGTAAGACGG - Intergenic
1022017237 7:26361196-26361218 TCTTACATGAACTAGTAAGATGG + Intronic
1022542316 7:31148991-31149013 TCTAATATGCAGAATTTACAAGG + Intergenic
1022755245 7:33280619-33280641 TGTGATATGCAAAAGTAAAATGG - Intronic
1022859625 7:34354224-34354246 TCTCATATGCAGAGGCCAGATGG - Intergenic
1023229593 7:38012652-38012674 TTTTAAATGAAGAAGTAAAAAGG - Intronic
1023590476 7:41776194-41776216 ACATATATTCAGAAGTAGGATGG + Intergenic
1024385196 7:48743081-48743103 ACTAAAATGCAGAAATAAGAGGG + Intergenic
1024406348 7:48985947-48985969 TCTAATATCCAGAAGTTATAAGG - Intergenic
1026333444 7:69373209-69373231 TCTTACATGAAGAAAAAAGAAGG + Intergenic
1027403353 7:77831956-77831978 TCTTATATGCAGAAGTAAGATGG + Intronic
1030210542 7:106991425-106991447 TCTTGTTTGCAGATATAAGAAGG + Intergenic
1030473781 7:110001939-110001961 TGTTGTATACAGAAGTCAGAAGG - Intergenic
1031105630 7:117538960-117538982 TCTCAAGTGCAGAACTAAGAGGG - Intronic
1031652458 7:124307103-124307125 TATTTTATGGAGAAGTAAGTGGG + Intergenic
1032306824 7:130741871-130741893 TCTTATAAGCAGAAATAAGAAGG - Intergenic
1032541359 7:132705702-132705724 CCTTATATGCAGAAGGAAACAGG + Intronic
1033609566 7:142952969-142952991 TCTCATAAGCATAAGTAAGCTGG + Intronic
1033626182 7:143111887-143111909 TGTTATCTGCAGAAGTAACTGGG - Intergenic
1036535803 8:9650506-9650528 CCATACTTGCAGAAGTAAGATGG + Intronic
1037023180 8:13999235-13999257 TCTTATACACAGAAGTGAGATGG - Intergenic
1039719612 8:40149291-40149313 TCTTATAAGAAGGAGTCAGAAGG - Intergenic
1042365068 8:67926631-67926653 TCTCAAATGAAGAAGTGAGATGG - Intergenic
1042999741 8:74743362-74743384 TGTTATAAGAAGTAGTAAGAAGG + Intronic
1044031813 8:87247697-87247719 TCTTACATACAGAAATGAGAGGG - Intronic
1044400918 8:91770855-91770877 TGGTATATGCAGGACTAAGATGG + Intergenic
1045407648 8:101882705-101882727 TCTTGTTTGCAAAAGTCAGAGGG - Intronic
1045927924 8:107592329-107592351 TTTAATATGCAGAAGGAAAAAGG + Intergenic
1046039277 8:108882747-108882769 TGATATATGCAGAGGTAACATGG - Intergenic
1048743331 8:137586352-137586374 TGTTATCTGCAGAAGTAATTGGG + Intergenic
1048966947 8:139622083-139622105 TCTTTCATGCTGTAGTAAGACGG - Intronic
1050323407 9:4477325-4477347 TCATAGATACAGAAGTAGGATGG + Intergenic
1050944500 9:11500402-11500424 TGTTATCTGCAGAAGTAATTGGG - Intergenic
1051972123 9:22901608-22901630 CCTTATAAGAAGAAGAAAGAGGG + Intergenic
1052702490 9:31953888-31953910 TGTTATATGCTGCAGTTAGATGG - Intergenic
1055179670 9:73369373-73369395 TCACAGATGCAAAAGTAAGATGG - Intergenic
1055350332 9:75380013-75380035 TCTTATCTGCAGAAGTTCCACGG - Intergenic
1056488037 9:87078490-87078512 TCTTATATGAAGAGACAAGAGGG + Intergenic
1058415792 9:104787482-104787504 TCTTATCTACAGAAGAAAAAAGG + Intronic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1058932824 9:109738626-109738648 TCTTCTATCCAGAAGAAAAAGGG + Intronic
1059895600 9:118860868-118860890 TCTTATATCCAGAATTTACAAGG + Intergenic
1062224630 9:135442741-135442763 TCTTTAATGCAGATGTAAGGTGG - Intergenic
1203734437 Un_GL000216v2:122423-122445 TATTATAGGCAGAAACAAGAAGG - Intergenic
1186055179 X:5642455-5642477 TATTATATCCAGAAGTAATATGG - Intergenic
1186876064 X:13819396-13819418 TTCTATATGTAGAAGTAGGATGG + Intronic
1188452129 X:30318491-30318513 TCTGATGTACAGAAGTAAAAAGG + Intergenic
1191816928 X:65255445-65255467 TCATAAATGCAGAAGAAATAAGG + Intergenic
1194399482 X:93425406-93425428 TCTCATTTGCTGAATTAAGAAGG + Intergenic
1196128284 X:112123948-112123970 TCTAATATCCAGAATTAACAAGG + Intergenic
1196316435 X:114230757-114230779 CCTAATATGCTAAAGTAAGATGG + Intergenic
1197052761 X:122079664-122079686 TATTATATGCAAAAGTTAGATGG + Intergenic
1198913978 X:141646262-141646284 ACTTATTGGCAGAAATAAGAGGG - Intronic
1199384804 X:147211439-147211461 TCTTATAAGTAGAAGGAAGGTGG - Intergenic
1199399312 X:147377978-147378000 GCTTACAAGCAGAAATAAGATGG - Intergenic
1199404432 X:147440631-147440653 ACTTATATGCAAAATTAAAAAGG + Intergenic