ID: 1027404192

View in Genome Browser
Species Human (GRCh38)
Location 7:77842354-77842376
Sequence CAAGATCTAGCTGGGCATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35826
Summary {0: 1, 1: 1, 2: 64, 3: 2609, 4: 33151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027404192_1027404196 -4 Left 1027404192 7:77842354-77842376 CCACTATGCCCAGCTAGATCTTG 0: 1
1: 1
2: 64
3: 2609
4: 33151
Right 1027404196 7:77842373-77842395 CTTGTATTTTTAGTAGAGACGGG 0: 883
1: 167020
2: 211372
3: 126703
4: 69367
1027404192_1027404195 -5 Left 1027404192 7:77842354-77842376 CCACTATGCCCAGCTAGATCTTG 0: 1
1: 1
2: 64
3: 2609
4: 33151
Right 1027404195 7:77842372-77842394 TCTTGTATTTTTAGTAGAGACGG 0: 1062
1: 197675
2: 142860
3: 66955
4: 40175
1027404192_1027404198 16 Left 1027404192 7:77842354-77842376 CCACTATGCCCAGCTAGATCTTG 0: 1
1: 1
2: 64
3: 2609
4: 33151
Right 1027404198 7:77842393-77842415 GGGGTTTTGCCATGTTGCCCAGG 0: 2928
1: 17678
2: 47547
3: 140385
4: 237725
1027404192_1027404197 -3 Left 1027404192 7:77842354-77842376 CCACTATGCCCAGCTAGATCTTG 0: 1
1: 1
2: 64
3: 2609
4: 33151
Right 1027404197 7:77842374-77842396 TTGTATTTTTAGTAGAGACGGGG 0: 98173
1: 216399
2: 153384
3: 81062
4: 60801

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027404192 Original CRISPR CAAGATCTAGCTGGGCATAG TGG (reversed) Intronic
Too many off-targets to display for this crispr