ID: 1027406159

View in Genome Browser
Species Human (GRCh38)
Location 7:77863497-77863519
Sequence CCTTATATGAAATCAATGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027406159_1027406161 22 Left 1027406159 7:77863497-77863519 CCTTACATTGATTTCATATAAGG 0: 1
1: 0
2: 2
3: 14
4: 189
Right 1027406161 7:77863542-77863564 ACCTATAGAGATTGATTTTTAGG 0: 1
1: 0
2: 0
3: 12
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027406159 Original CRISPR CCTTATATGAAATCAATGTA AGG (reversed) Intronic
905460078 1:38116886-38116908 AATTAGATGAATTCAATGTAGGG + Intergenic
908176710 1:61562973-61562995 TCTTATCTTAAATCAATGGAAGG + Intergenic
909155308 1:72067036-72067058 CCTAACATGAAATAAATGTAAGG - Intronic
909189010 1:72527943-72527965 CCTTAAAGGAAATCAATGCTGGG + Intergenic
909524666 1:76609532-76609554 CCCTATATTAAATTAATTTATGG - Intronic
910903325 1:92146026-92146048 TCTTATCTGAGATCAATATAGGG + Intronic
911077070 1:93886838-93886860 ACTTATATGAAAAAAATGTTGGG + Exonic
911357192 1:96836876-96836898 CATTATATGAGCTCAATGTAAGG + Intergenic
911789975 1:102002032-102002054 ACATAAATGAATTCAATGTAAGG - Intergenic
913697298 1:121339687-121339709 CCTTATATTAAATGGAAGTAGGG - Intronic
914140260 1:144940366-144940388 CCTTATATTAAATGGAAGTAGGG + Intronic
914723996 1:150312080-150312102 CCTCCTCTGAAATCAATGCAGGG - Intergenic
917023634 1:170616655-170616677 CCTTAATTGAAATCAATTTCAGG - Intergenic
917311746 1:173685918-173685940 CCTTTAATAAAATGAATGTATGG + Intergenic
918678967 1:187327246-187327268 CCTTATATGTGAACAATTTAAGG + Intergenic
919660854 1:200244286-200244308 CCTTAGATGAAATCTATGATGGG - Intergenic
920484632 1:206358019-206358041 CCTTATATTAAATGGAAGTAGGG - Intronic
1063697740 10:8353391-8353413 CCTGATATGCACTCTATGTATGG + Intergenic
1063869338 10:10401309-10401331 AATTCTATGAAACCAATGTATGG - Intergenic
1067491983 10:46717236-46717258 CCATATAGGAAATGAATATAAGG - Intergenic
1067602674 10:47623145-47623167 CCATATAGGAAATGAATATAAGG + Intergenic
1068100104 10:52542145-52542167 CCTTCTGTGAGATCAATATATGG - Intergenic
1069285174 10:66705160-66705182 CATTAAAACAAATCAATGTAAGG - Intronic
1070875309 10:79799972-79799994 CCTAATATAAAACTAATGTATGG + Intergenic
1071642236 10:87322119-87322141 CCTAATATAAAACTAATGTATGG + Intergenic
1071654031 10:87428556-87428578 CCATATAGGAAATGAATATAAGG + Intergenic
1072723236 10:97793746-97793768 CTTTATATGAAATAAAAGAAAGG - Intergenic
1073108168 10:101044974-101044996 CCTTACCTGAGATCAATATATGG - Intergenic
1073668432 10:105560152-105560174 CCTTATATTAAGTAAATGTCAGG - Intergenic
1075913038 10:126142368-126142390 CCTTATGGGAAATGAATGGATGG + Intronic
1080913747 11:36632925-36632947 CTTTATATGAAAGCAATGTATGG - Intronic
1081974153 11:47220855-47220877 CCTATTATAAAAACAATGTATGG + Intronic
1085709325 11:78814801-78814823 CTTTATATCAAAACAAAGTATGG - Intronic
1085857601 11:80193113-80193135 CCTTACATGACAAAAATGTAAGG + Intergenic
1086014695 11:82153327-82153349 CCTGATAAGGAAGCAATGTATGG - Intergenic
1086367237 11:86119796-86119818 CCTTAAATGAAATCAATGGCTGG - Intergenic
1086855395 11:91859719-91859741 TCTTATTTGGAATCAATGTGAGG + Intergenic
1087526780 11:99324510-99324532 TCTTATTTGAAATATATGTATGG + Intronic
1087570011 11:99914330-99914352 CTTAATATGAAATCAAAGCATGG - Intronic
1087665837 11:101046598-101046620 CCTTTTATAAAATAAATGCAAGG - Intronic
1089846153 11:121460262-121460284 TCTTACATGAAATAAATGTGGGG + Intronic
1091158699 11:133399090-133399112 TCTTATCTGAAATAAATGTTAGG + Intronic
1093279211 12:17170902-17170924 CTTGATATGAAATCAATACAGGG + Intergenic
1093446775 12:19268754-19268776 CCATATTTGTGATCAATGTAAGG - Intronic
1096330902 12:50711860-50711882 CCTTTTATTAAAACAATTTAAGG - Intronic
1097854733 12:64450867-64450889 CCTTATAAGAAAACACTGTGTGG + Exonic
1098403712 12:70101645-70101667 ACTGGTATGAAATCAAGGTATGG - Intergenic
1098762590 12:74443760-74443782 ACTTATATTTAATAAATGTATGG + Intergenic
1099333292 12:81319667-81319689 CCTTAGATGAAATCCTTTTATGG - Intronic
1100100497 12:91098008-91098030 CAAGATATGGAATCAATGTAAGG + Intergenic
1100588627 12:96002920-96002942 TCTTAGATGAATTCAAAGTACGG + Intronic
1101233034 12:102761381-102761403 GATTAAATGAAATAAATGTAAGG - Intergenic
1101290680 12:103364995-103365017 CCTAATATGAAAACAAGGGAAGG + Intronic
1102602470 12:114042420-114042442 CCCTGAATCAAATCAATGTAGGG - Intergenic
1106318540 13:28617068-28617090 TTTTAGATGAAAGCAATGTAGGG - Intergenic
1106797412 13:33220867-33220889 CCTTCTATAAAATGAATGGAGGG + Intronic
1108318625 13:49263992-49264014 CCTTATAAGAAAACACTGTGTGG - Intronic
1109799134 13:67351934-67351956 CATTCTATGAAATCAGTGGATGG + Intergenic
1111573301 13:90116488-90116510 CCATATCTAAAATAAATGTAAGG - Intergenic
1114033351 14:18596044-18596066 CCTTACATGAAAACAATATCTGG + Intergenic
1114078146 14:19175244-19175266 CCTTACATGAAAACAATATCTGG + Intergenic
1114125349 14:19719309-19719331 CCTTACATGAAAACAATATCTGG - Intronic
1114453342 14:22840382-22840404 CCTTAAATTAAATTAATGTTAGG - Intronic
1119815953 14:77567468-77567490 CCTTGTAAGACATAAATGTATGG - Intronic
1129026654 15:72581680-72581702 TCTTATAAGAAAACACTGTATGG - Intronic
1129116343 15:73367480-73367502 CCTTACCTGAAGTCACTGTAGGG + Exonic
1129545175 15:76388274-76388296 GCATATATGAAATAAATCTATGG + Intronic
1129893559 15:79088085-79088107 GATGATTTGAAATCAATGTAGGG + Intronic
1136670983 16:31857159-31857181 CCTGATATGAAAACAATACAAGG + Intergenic
1137917686 16:52450683-52450705 CCTTATATTTAATAAATGAACGG - Intronic
1144115839 17:12089483-12089505 CATTAGAGGAAATCAGTGTAGGG - Intronic
1146675412 17:34770192-34770214 CCTTCTCTTAAATCACTGTATGG + Intergenic
1148177560 17:45580680-45580702 CCTTTTATGGAAAAAATGTAAGG - Intergenic
1148883453 17:50751967-50751989 CCTTTTGGGAAAGCAATGTAAGG + Exonic
1150747772 17:67829948-67829970 CCTTTTATGGAAAAAATGTAAGG + Intronic
1153874315 18:9353422-9353444 GCTTATATGAAATGAAAGTCTGG - Intronic
1155219796 18:23673851-23673873 AATAATATGAATTCAATGTATGG - Intergenic
1156693030 18:39731382-39731404 TCTAATATGAAGTCATTGTATGG - Intergenic
1160456195 18:79003184-79003206 CCTTAAATGATCTCAATGTGTGG - Intergenic
1161710740 19:5846425-5846447 CCTTAAATGGATTCACTGTATGG + Exonic
1163707170 19:18821348-18821370 CCTTATAAGAAATCTATTTCTGG + Intergenic
1165948023 19:39456857-39456879 ACATATATGAAATCCATGTAAGG - Intronic
1168303892 19:55423412-55423434 CATTATATGACATCATTGTATGG - Intergenic
928945104 2:36765078-36765100 CCTTATATGGAAAAAATGTGGGG + Intronic
929258070 2:39835124-39835146 CCTTATATCAAAACCATGTAAGG - Intergenic
929771977 2:44900094-44900116 CCTATTAGGAACTCAATGTATGG - Intergenic
930240323 2:48929538-48929560 GCCTATTTGAAATCTATGTAGGG - Intergenic
930549043 2:52808624-52808646 CCTAATATCAAAGCAATGAAAGG - Intergenic
930918619 2:56723983-56724005 CCTTATAGGAAACGAATGGATGG - Intergenic
931128712 2:59307187-59307209 GGTTATATGAAATCAACCTAAGG + Intergenic
933453113 2:82482821-82482843 CCTGATATGAACACACTGTAGGG - Intergenic
936523990 2:113230436-113230458 CCATTTATAAGATCAATGTAGGG - Intronic
939202293 2:139052820-139052842 CCATATATGAGTTGAATGTATGG + Intergenic
940323773 2:152403767-152403789 AATTATAAGAAATAAATGTAGGG + Intronic
941983173 2:171482723-171482745 CCTTTTATGAAATGATAGTAAGG + Exonic
943589037 2:189775274-189775296 CCTTATATGAAACCTAAGGACGG + Intronic
945340239 2:208643909-208643931 TCTTATATGATGTCAATGTCAGG + Intronic
947477410 2:230462761-230462783 CCTACTATATAATCAATGTATGG - Intronic
947628947 2:231639390-231639412 ACTTATATAAAATAAATGTGAGG + Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1174740727 20:53011699-53011721 TCTTATATAAAAGCAATATATGG - Intronic
1175271676 20:57738462-57738484 TCTTATCTGAAATCAAGGTGTGG + Intergenic
1175670813 20:60901261-60901283 CATTATATGAAAGGAAGGTAGGG + Intergenic
1177284730 21:19035257-19035279 CCTTCTATGAAGTCATTTTAAGG - Intergenic
1178142126 21:29696369-29696391 CTTTATTTGAAATGAACGTAAGG + Intronic
1179963075 21:44781822-44781844 CATTTTATGAAATCATAGTAGGG + Intronic
1180457466 22:15523099-15523121 CCTTACATGAAAACAATATCTGG + Intergenic
1182353698 22:29712736-29712758 CCTTTTATGAACTCAATCCAAGG + Intergenic
1184946307 22:47806758-47806780 CCTGGTAGGAATTCAATGTAGGG + Intergenic
949242690 3:1890734-1890756 CCTTTAGTGAAATGAATGTATGG - Intergenic
951299701 3:20979949-20979971 CCTGATATGAGATCAATATTAGG + Intergenic
953600238 3:44356024-44356046 CCTTTTATAAAGTCAATATATGG - Intronic
953686641 3:45083159-45083181 CCTTATTTGAATTCACTGTGTGG - Exonic
963596199 3:147328250-147328272 CATAATATGAGATCAATGTCTGG + Intergenic
965172145 3:165279610-165279632 CCTTGCATGTAATCAATGAAAGG - Intergenic
965731610 3:171778034-171778056 ACATATATGAATGCAATGTAAGG - Intronic
965867827 3:173226962-173226984 CATTATATGAAAACAGTGCATGG - Intergenic
968322526 3:197783034-197783056 CCATATAAGAAATCAGTGAAAGG - Exonic
970909675 4:21260198-21260220 CCTTTTATGAAAGCACAGTAAGG - Intronic
971094921 4:23389842-23389864 GCTTTTATGAATTCAATGTATGG + Intergenic
973854500 4:54997196-54997218 ATTTATATGAAATGAATGCATGG - Intergenic
974835704 4:67247691-67247713 CCTTTTATGAAATAAATTTTGGG - Intergenic
977016281 4:91696372-91696394 CCTTATTGGAAATAAAGGTATGG + Intergenic
977128555 4:93202424-93202446 ACGTATTTGAAATCAATGAAAGG - Intronic
977271759 4:94925876-94925898 CTTTATAAGAATTCAATGAATGG + Intronic
978187238 4:105870946-105870968 CCTTTTATGAAATCACTGAATGG + Intronic
978252060 4:106642874-106642896 TCTTATACAAAATAAATGTAGGG + Intergenic
978505976 4:109456459-109456481 CCTTCCATGTAATCAATGTTAGG + Intronic
979890245 4:126083090-126083112 CCTTATAAAAAATCAATATTTGG + Intergenic
980192365 4:129541364-129541386 CCTTAGATGATATCTTTGTATGG - Intergenic
980244631 4:130223659-130223681 CCTTATCTGAAATGAATCCAGGG - Intergenic
980762212 4:137250293-137250315 CCTAATATTAAAACAATGTTTGG - Intergenic
984887583 4:184464359-184464381 CCATATATGACATGAAGGTAGGG + Intronic
985876051 5:2596448-2596470 CCATTTTTAAAATCAATGTAAGG - Intergenic
987518572 5:18947747-18947769 AGATATATGATATCAATGTAAGG + Intergenic
987797192 5:22643057-22643079 GCTTAAATCAAATCAAAGTAAGG + Intronic
988342884 5:29997952-29997974 CCTTAACTAAAATCTATGTAAGG - Intergenic
988658704 5:33240513-33240535 TCTTTTATGAAATGATTGTAAGG - Intergenic
988873641 5:35419313-35419335 CCTTACATGAACTCAATCTCAGG - Intergenic
989419780 5:41223758-41223780 CCTTATATTAAATAAAAGTACGG - Intronic
989812526 5:45695663-45695685 CCTCACCTGAAATCACTGTAAGG + Exonic
991596712 5:68314147-68314169 CCTTAATGGAAATCAGTGTATGG + Intergenic
993056441 5:82986115-82986137 CCATACATGAAATTAATGAATGG + Intergenic
993062009 5:83049957-83049979 CTAAATATGAAATCAATGTGTGG + Intergenic
993404139 5:87489837-87489859 CCTAATGTGAAAACAATCTATGG - Intergenic
994490867 5:100441630-100441652 CCTTTTATGAAAGCAATATGGGG + Intergenic
994818327 5:104613662-104613684 ACTAATATGAAATAAATGTGAGG + Intergenic
995667288 5:114556371-114556393 TAATATATGAAAACAATGTAAGG - Intergenic
998027206 5:138828556-138828578 AATTATATGAAATCATTTTAAGG + Intronic
998437385 5:142123589-142123611 TCTTAGATGAAATCTATATACGG + Intronic
999166968 5:149557759-149557781 CATTAATTGAAATAAATGTATGG - Intronic
999744401 5:154580746-154580768 CCTTATATAAAATAAACTTATGG - Intergenic
1000743951 5:165007027-165007049 CATTATATGATATGAATATATGG + Intergenic
1001191351 5:169635531-169635553 CCTTAATTAAATTCAATGTATGG - Intergenic
1002911487 6:1494391-1494413 CCTTACATGACATGAATGTAAGG + Intergenic
1004115776 6:12766273-12766295 CCTTCTATGAATTAATTGTAAGG - Intronic
1004410929 6:15380892-15380914 CCATATTTGAAATGAATGTCTGG + Intronic
1004602899 6:17167624-17167646 TCTAATATGCAATCAATGTCGGG - Intergenic
1005163768 6:22895512-22895534 TCTCATATGTAATAAATGTATGG - Intergenic
1005474333 6:26192671-26192693 CCTTTTACGAAATCGATGTAGGG + Intergenic
1005726753 6:28656861-28656883 TCTTATATGAAATAAATTTAGGG + Intergenic
1006714289 6:36105019-36105041 CATTATATGACATCACTGTTTGG - Intronic
1008700258 6:54090842-54090864 ACTTATTTGAGATTAATGTAGGG + Intronic
1009614490 6:65987668-65987690 CCTTTTGTGAAATAAATTTATGG - Intergenic
1010016318 6:71108490-71108512 CCATTTATGAAATCAATATTAGG + Intergenic
1010510882 6:76717827-76717849 TCTAATATAAAATCAATGTAAGG - Intergenic
1010909254 6:81533320-81533342 CCTTATCTGAAAATAATTTATGG + Intronic
1013941519 6:115668758-115668780 CCCTATAGGAAATCAAAGTCTGG - Intergenic
1024723756 7:52168986-52169008 CCTTGTATGAAATCAGGGAAAGG + Intergenic
1026061990 7:67034669-67034691 TATTAGATGAATTCAATGTAAGG + Intronic
1026716360 7:72792771-72792793 TATTAGATGAATTCAATGTAAGG - Intronic
1027406159 7:77863497-77863519 CCTTATATGAAATCAATGTAAGG - Intronic
1027786800 7:82590346-82590368 ACTTTTATGTAATTAATGTAGGG - Intergenic
1028802145 7:94978198-94978220 TCTTATAAGAAATCACTTTATGG - Intronic
1028895659 7:96039064-96039086 CATTATTTAAAAACAATGTAGGG - Intronic
1030133805 7:106226933-106226955 CCATTTATGAAACAAATGTAGGG + Intergenic
1037718807 8:21423176-21423198 CCTTACATCACATGAATGTATGG - Intergenic
1038062158 8:23925555-23925577 CCTTATTTGAAAAAAATGAAAGG - Intergenic
1039671809 8:39609571-39609593 CCTTATAAGAAATCTATAGATGG + Intronic
1040486694 8:47879752-47879774 CATTATGTGGAATCAATGAATGG + Intronic
1040528850 8:48248948-48248970 CATGCTATAAAATCAATGTATGG + Intergenic
1041544833 8:59031380-59031402 TCTTATATAAAATCAATAAATGG - Intronic
1043007193 8:74834254-74834276 CCTCAGATGAAATCCATGTAGGG - Intronic
1043607024 8:82013259-82013281 AAATATATGAAATCAATGAAGGG - Intergenic
1045721680 8:105119014-105119036 ACTTGTTTGAAATCAATGTTGGG + Intronic
1045771951 8:105752654-105752676 CCTTATTTGAAATGAACTTAAGG + Intronic
1046373849 8:113349715-113349737 TCTTATATAATATCAATTTAAGG - Intronic
1047119296 8:121882640-121882662 CATTCTTTAAAATCAATGTAGGG + Intergenic
1047471929 8:125183168-125183190 CCTTATATGTGCTTAATGTAGGG + Intronic
1047718371 8:127616522-127616544 CCTTATGGGAAATGAATGTGAGG + Intergenic
1055467046 9:76576285-76576307 CTTTATGTGTAATCAGTGTAGGG - Intergenic
1058282845 9:103138401-103138423 ACTTATATTAAAACAATTTATGG + Intergenic
1059875871 9:118634155-118634177 CCTTATGGGAAATGAATGGATGG + Intergenic
1186982988 X:14978166-14978188 CATTACATGAAATCAATTAAAGG - Intergenic
1187044313 X:15631053-15631075 CCTAAAATGAACTCAATGAAAGG + Intronic
1190926476 X:54910358-54910380 CCATATTTGAAATGAATGAAGGG - Intergenic
1192371396 X:70516280-70516302 CCTTATATAAAATTAATTCAAGG - Intergenic
1193472507 X:81924600-81924622 CCTTACAAGAATTCAATGTGAGG - Intergenic
1197098682 X:122625721-122625743 CCTTATAAGAAAGAAAAGTAAGG + Intergenic
1197687856 X:129461537-129461559 CCTTTTAGGAAATGAATGTCAGG - Intronic
1198424466 X:136502145-136502167 CTTTATATTAAATACATGTATGG - Intronic
1198525069 X:137492603-137492625 CCTTATAGCAAATCAATGTAGGG + Intergenic
1198759739 X:140018789-140018811 GCTTGAATAAAATCAATGTAAGG + Intergenic
1201369952 Y:13252804-13252826 CCTTATGGGAAATCAAGGGATGG - Intronic
1202132304 Y:21624308-21624330 CCTTATAGGAAATGAAGGGATGG + Intergenic
1202579491 Y:26364753-26364775 CCTTATATAAAATTATTGGAGGG - Intergenic